ID: 1037360461

View in Genome Browser
Species Human (GRCh38)
Location 8:18068672-18068694
Sequence GGGGCTGTCATGTGCATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2406
Summary {0: 2, 1: 37, 2: 249, 3: 688, 4: 1430}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037360461_1037360465 2 Left 1037360461 8:18068672-18068694 CCTGCAATGCACATGACAGCCCC 0: 2
1: 37
2: 249
3: 688
4: 1430
Right 1037360465 8:18068697-18068719 AAAAAAGAGACACCCACCCCAGG 0: 2
1: 0
2: 2
3: 18
4: 291
1037360461_1037360467 7 Left 1037360461 8:18068672-18068694 CCTGCAATGCACATGACAGCCCC 0: 2
1: 37
2: 249
3: 688
4: 1430
Right 1037360467 8:18068702-18068724 AGAGACACCCACCCCAGGCCGGG 0: 2
1: 0
2: 4
3: 38
4: 411
1037360461_1037360466 6 Left 1037360461 8:18068672-18068694 CCTGCAATGCACATGACAGCCCC 0: 2
1: 37
2: 249
3: 688
4: 1430
Right 1037360466 8:18068701-18068723 AAGAGACACCCACCCCAGGCCGG 0: 2
1: 0
2: 2
3: 29
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037360461 Original CRISPR GGGGCTGTCATGTGCATTGC AGG (reversed) Intronic
Too many off-targets to display for this crispr