ID: 1037360461 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:18068672-18068694 |
Sequence | GGGGCTGTCATGTGCATTGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 2406 | |||
Summary | {0: 2, 1: 37, 2: 249, 3: 688, 4: 1430} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1037360461_1037360466 | 6 | Left | 1037360461 | 8:18068672-18068694 | CCTGCAATGCACATGACAGCCCC | 0: 2 1: 37 2: 249 3: 688 4: 1430 |
||
Right | 1037360466 | 8:18068701-18068723 | AAGAGACACCCACCCCAGGCCGG | 0: 2 1: 0 2: 2 3: 29 4: 224 |
||||
1037360461_1037360465 | 2 | Left | 1037360461 | 8:18068672-18068694 | CCTGCAATGCACATGACAGCCCC | 0: 2 1: 37 2: 249 3: 688 4: 1430 |
||
Right | 1037360465 | 8:18068697-18068719 | AAAAAAGAGACACCCACCCCAGG | 0: 2 1: 0 2: 2 3: 18 4: 291 |
||||
1037360461_1037360467 | 7 | Left | 1037360461 | 8:18068672-18068694 | CCTGCAATGCACATGACAGCCCC | 0: 2 1: 37 2: 249 3: 688 4: 1430 |
||
Right | 1037360467 | 8:18068702-18068724 | AGAGACACCCACCCCAGGCCGGG | 0: 2 1: 0 2: 4 3: 38 4: 411 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1037360461 | Original CRISPR | GGGGCTGTCATGTGCATTGC AGG (reversed) | Intronic | ||