ID: 1037360465 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:18068697-18068719 |
| Sequence | AAAAAAGAGACACCCACCCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 313 | |||
| Summary | {0: 2, 1: 0, 2: 2, 3: 18, 4: 291} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1037360461_1037360465 | 2 | Left | 1037360461 | 8:18068672-18068694 | CCTGCAATGCACATGACAGCCCC | 0: 2 1: 37 2: 249 3: 688 4: 1430 |
||
| Right | 1037360465 | 8:18068697-18068719 | AAAAAAGAGACACCCACCCCAGG | 0: 2 1: 0 2: 2 3: 18 4: 291 |
||||
| 1037360460_1037360465 | 22 | Left | 1037360460 | 8:18068652-18068674 | CCAGGGACACTGCTAAACATCCT | 0: 8 1: 68 2: 253 3: 1004 4: 1675 |
||
| Right | 1037360465 | 8:18068697-18068719 | AAAAAAGAGACACCCACCCCAGG | 0: 2 1: 0 2: 2 3: 18 4: 291 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1037360465 | Original CRISPR | AAAAAAGAGACACCCACCCC AGG | Intronic | ||