ID: 1037360467

View in Genome Browser
Species Human (GRCh38)
Location 8:18068702-18068724
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 2, 1: 0, 2: 4, 3: 38, 4: 411}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037360461_1037360467 7 Left 1037360461 8:18068672-18068694 CCTGCAATGCACATGACAGCCCC 0: 2
1: 37
2: 249
3: 688
4: 1430
Right 1037360467 8:18068702-18068724 AGAGACACCCACCCCAGGCCGGG 0: 2
1: 0
2: 4
3: 38
4: 411
1037360460_1037360467 27 Left 1037360460 8:18068652-18068674 CCAGGGACACTGCTAAACATCCT 0: 8
1: 68
2: 253
3: 1004
4: 1675
Right 1037360467 8:18068702-18068724 AGAGACACCCACCCCAGGCCGGG 0: 2
1: 0
2: 4
3: 38
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900392490 1:2439811-2439833 AGAGACACCGCAGCCAGGCCTGG + Intronic
900412188 1:2517651-2517673 AGTGCCACCCAGCTCAGGCCAGG + Intronic
900556100 1:3281344-3281366 TGAGACGCCCACCCCAGCCATGG + Intronic
900780143 1:4612575-4612597 AGAGACCCCAACCCCATCCCTGG - Intergenic
901049304 1:6418524-6418546 CGACACACCCACCCCAGCACTGG - Exonic
901290671 1:8121838-8121860 ACAGGCACACACACCAGGCCTGG - Intergenic
901702997 1:11055402-11055424 AAAAAAACCCTCCCCAGGCCAGG - Intronic
901987625 1:13088703-13088725 AGAGACATCATCCCCAGGCTTGG + Intergenic
901994187 1:13138064-13138086 AGAGACATCATCCCCAGGCTTGG - Intergenic
902079479 1:13811492-13811514 CCACACACCCTCCCCAGGCCCGG - Intronic
902338587 1:15768023-15768045 ACAGGCACCCACACCATGCCTGG + Intronic
902399595 1:16150717-16150739 AGAGTCAGCCGGCCCAGGCCAGG - Intronic
902429093 1:16348557-16348579 ACAGGCACCCGCCCCACGCCCGG - Intronic
902533316 1:17104574-17104596 ACAGGCACCCGCCCCATGCCTGG + Intronic
902654707 1:17859412-17859434 AGAGACAGCCCCTTCAGGCCAGG - Intergenic
903189483 1:21648865-21648887 TGTGCCTCCCACCCCAGGCCTGG + Intronic
904213911 1:28904605-28904627 AGAGACACCAAGGCCAGGCGCGG + Intronic
905149896 1:35919376-35919398 AGAGAAACCCAACCCAGGATTGG - Intronic
905217225 1:36417373-36417395 AAAGACACCCAGCATAGGCCGGG - Intronic
905242600 1:36590489-36590511 ACACACACCCACTCAAGGCCTGG + Intergenic
905460270 1:38118268-38118290 AGAGACACTCACGACAGGCATGG - Intergenic
907249857 1:53130835-53130857 AGGGACACCCAGCCCTGGGCTGG + Intronic
907368636 1:53982807-53982829 TGAGCAACCCACTCCAGGCCAGG + Intergenic
908592950 1:65652738-65652760 AGGGGCACCCACCCGATGCCAGG - Intergenic
908697721 1:66863599-66863621 ACAGGCACCCACACCACGCCTGG + Intronic
908833306 1:68203446-68203468 AGTGACACCCAGCCCAGTGCTGG - Intronic
912943545 1:114066396-114066418 ACAGGCACCCACCCCACGCCCGG + Intergenic
913388750 1:118287582-118287604 AGAGACACACTTCCCAGGACTGG + Intergenic
913971672 1:143421857-143421879 AGAGGCCCCCACCCCACCCCAGG - Intergenic
914066049 1:144247470-144247492 AGAGGCCCCCACCCCACCCCAGG - Intergenic
914113102 1:144718884-144718906 AGAGGCCCCCACCCCACCCCAGG + Intergenic
915208640 1:154289538-154289560 TGAGACACCGCCCCCAGCCCTGG + Intergenic
915368113 1:155326620-155326642 AGGGACAACCACCGCGGGCCAGG - Exonic
915978560 1:160406468-160406490 AAAGAGACCCACCCCAGGAGAGG - Intronic
916122933 1:161544964-161544986 AGACACAGACACCCCAGGCCCGG + Intronic
916715066 1:167441161-167441183 AGAGCCACACACCTCAGGCCAGG - Intronic
916860807 1:168803025-168803047 AGGGACACCTAACCCAGTCCAGG - Intergenic
918107186 1:181425280-181425302 CGAGACTCCCACCGCAGTCCAGG + Intronic
918177286 1:182057377-182057399 AGAGACACATACACCAGCCCAGG - Exonic
918304624 1:183234779-183234801 AGGGACTCCCACACCAAGCCTGG + Intronic
920368918 1:205465047-205465069 ACAGGCACCCGCCCCATGCCTGG + Intergenic
921131083 1:212220611-212220633 AAAGATACCTACCTCAGGCCGGG + Intergenic
921239925 1:213168762-213168784 ACAGGCACCCACCACATGCCCGG + Intronic
921280956 1:213567850-213567872 AGAGAAACCCATCCCTGGCCTGG + Intergenic
922573551 1:226647431-226647453 AGAGGCACCCTCCCCAGCACAGG + Intronic
922788772 1:228298057-228298079 GGAGATACCCATCCCAGGCAGGG - Intronic
923208131 1:231778082-231778104 AGAGACAACCATCCCTGGCCTGG - Intronic
923717648 1:236438463-236438485 AGTGGCACCCACCACAGCCCTGG - Intronic
1062895860 10:1102685-1102707 CCAGACACCCCCACCAGGCCCGG + Intronic
1063391226 10:5650992-5651014 AGAGTCACCCACCCCAGCCCTGG + Intronic
1065223053 10:23515428-23515450 AGAAACAGCTACACCAGGCCAGG - Intergenic
1065293198 10:24251460-24251482 GGAGAAACTGACCCCAGGCCAGG - Intronic
1065872632 10:29968632-29968654 AGAGAGATCCAGCCGAGGCCTGG - Intergenic
1066557041 10:36625497-36625519 ACACACACACACCCCAGGCATGG - Intergenic
1067148803 10:43712631-43712653 AAAAACTCCCACCCCTGGCCTGG - Intergenic
1067239308 10:44476733-44476755 GGGGACACCAACCCCAGTCCAGG - Intergenic
1067765101 10:49079705-49079727 AGAGACACCCAGCCCAGCCTGGG + Intronic
1069860190 10:71465990-71466012 AGAGCCGCCCAGCACAGGCCGGG - Intronic
1069900060 10:71701967-71701989 AGAGACACCCTCCCCAGGCGCGG + Intronic
1070241700 10:74688617-74688639 AGAGTAACCCACGCTAGGCCAGG + Intronic
1071858649 10:89650451-89650473 AGAGGCACCCAACCCAGCCTGGG - Intergenic
1072040735 10:91603773-91603795 AGAGACTCCCACACTAGGTCAGG + Intergenic
1073119850 10:101114923-101114945 AGAGACAGCCCCCCCAGCCGAGG - Intronic
1075563486 10:123485976-123485998 AGAGAGCCCCACTCCAGGGCTGG - Intergenic
1075712034 10:124535995-124536017 AGAACCTCCCACCCCAGCCCAGG - Intronic
1076570373 10:131428727-131428749 AGAAACAACCATTCCAGGCCGGG - Intergenic
1076872317 10:133200114-133200136 AAGGGCACCCACCCCAGCCCCGG + Intronic
1077009345 11:373290-373312 AGGTACCCCCACCCCAGCCCTGG + Exonic
1077076728 11:705609-705631 AGCCATGCCCACCCCAGGCCTGG - Intronic
1077186057 11:1235958-1235980 AGAGACACCCACTCCAGCAAAGG + Intronic
1077193006 11:1263309-1263331 AGGGCCAGCCACCCCAGGACTGG + Intergenic
1077264824 11:1643290-1643312 AGAGAGACCCGCCCCAGCGCTGG + Intergenic
1077308200 11:1877170-1877192 AGAGGCCCCCACCCCACCCCAGG + Intronic
1077437457 11:2549715-2549737 AGGCACCCCCACACCAGGCCTGG - Intronic
1077475593 11:2788869-2788891 AGACACACCCACCCCTGTGCAGG - Intronic
1078340511 11:10495271-10495293 AGAGACACGAAAGCCAGGCCAGG - Intronic
1079361568 11:19774622-19774644 AGAGACACATACCCCAGACAAGG + Intronic
1079446963 11:20566365-20566387 AGATACACCCACCCTCGACCTGG + Intergenic
1079447914 11:20573081-20573103 AGATACACCCACCCTCGACCTGG - Intergenic
1079535799 11:21513916-21513938 TGAGACACCCACCCCTGCCTGGG + Intronic
1080746002 11:35109371-35109393 AGACCCACCCATCACAGGCCTGG + Intergenic
1080896919 11:36455203-36455225 AGGGACACCCACCACGGGCTTGG + Intronic
1081530218 11:43953377-43953399 ACAGGCACCCACCACACGCCTGG - Intergenic
1081775529 11:45673750-45673772 AGGCAAACCCAGCCCAGGCCTGG + Intergenic
1083193852 11:61071427-61071449 AGAGACACCCACCAGAGGTGAGG + Intergenic
1083231109 11:61320340-61320362 ACAGGCACCCACACCATGCCTGG + Intronic
1083867910 11:65467983-65468005 AAAAACACCCATCTCAGGCCGGG + Intergenic
1084660789 11:70545134-70545156 AGAGACGCCCACGGCAGGACTGG - Intronic
1089538223 11:119173647-119173669 AGCATCAGCCACCCCAGGCCGGG + Exonic
1089711729 11:120319737-120319759 AAAGATTCCCAGCCCAGGCCAGG - Exonic
1090082359 11:123622474-123622496 AGAAAACCCCACCCCAGGCCTGG - Intronic
1090285465 11:125495822-125495844 ACACACACACACACCAGGCCTGG + Intronic
1091552707 12:1548881-1548903 ACAGGCACCCACACCATGCCTGG - Intronic
1092172870 12:6384386-6384408 AGAGGCCCCCAGGCCAGGCCGGG - Exonic
1094642262 12:32287830-32287852 AGAACCACCCAGCCGAGGCCGGG - Intronic
1095365192 12:41395068-41395090 AAATACACCCACCCCTGTCCAGG + Intronic
1096188469 12:49599348-49599370 GGGGAGAGCCACCCCAGGCCTGG - Intronic
1096550065 12:52366230-52366252 TGTGACAGCCAACCCAGGCCTGG - Intronic
1096628843 12:52912528-52912550 ACAGATGCCCACCCTAGGCCTGG + Intronic
1096876201 12:54632310-54632332 AGAGACAACCACAACAGCCCAGG - Exonic
1100195614 12:92241155-92241177 AGAGAAAACCCACCCAGGCCTGG + Intergenic
1100343791 12:93707455-93707477 AGAGCCACGCACCCCAGTCAAGG - Intronic
1102547273 12:113666015-113666037 ACACAAAACCACCCCAGGCCAGG - Intergenic
1103510073 12:121467691-121467713 AAAGGACCCCACCCCAGGCCGGG - Intronic
1103791827 12:123477623-123477645 AAAGACACCAACTCCTGGCCAGG - Intronic
1103900726 12:124302537-124302559 AGAAAGACCCACCCCTGCCCCGG + Intronic
1104795094 12:131511723-131511745 TGAGACAGTCACCCCAGGCTGGG + Intergenic
1104814440 12:131637724-131637746 AGAGACCCCCTGACCAGGCCTGG + Intergenic
1104971956 12:132534828-132534850 AGAGCCCCCCAGCCCAGCCCAGG + Intronic
1106121007 13:26860084-26860106 AGAGTGACCAACCCCAGCCCAGG - Intergenic
1106231589 13:27825189-27825211 AGAGACACACAGCTCAGGGCTGG + Intergenic
1108227353 13:48303517-48303539 AGAACCACCCCCTCCAGGCCGGG - Intergenic
1108262507 13:48672909-48672931 TGAGAAACTCACTCCAGGCCAGG - Intronic
1111269982 13:85869079-85869101 ACAGGCACCCGCCCCAAGCCCGG + Intergenic
1112398794 13:99058113-99058135 AGAATCACCCCACCCAGGCCTGG - Intronic
1113472353 13:110555938-110555960 AGTGACAGGCACCCAAGGCCAGG + Intronic
1116112435 14:40604032-40604054 ACAGGCACCCACACCACGCCTGG - Intergenic
1117518295 14:56524524-56524546 CCAGACACCTACCCCAGGCTTGG - Intronic
1119645897 14:76348280-76348302 CCAGACACCCACCACAGGGCTGG - Intronic
1120067171 14:80056242-80056264 ACACACACACACCCCAGGCCTGG - Intergenic
1120962238 14:90136013-90136035 AGACACACACACACCTGGCCCGG + Intronic
1122029574 14:98902397-98902419 AGAAGCACCCACCCCAGCCTTGG - Intergenic
1122481375 14:102049624-102049646 AGCCACTCCCACCCCAGCCCAGG - Intronic
1122599512 14:102914396-102914418 AAGGACACAGACCCCAGGCCTGG - Intergenic
1123404107 15:20010235-20010257 ACAGCCACCCACCCCTGTCCAGG - Intergenic
1123513445 15:21016881-21016903 ACAGCCACCCACCCCTGTCCAGG - Intergenic
1123701377 15:22917080-22917102 CGACACACACACCCCAGGCAGGG + Intronic
1123991524 15:25687113-25687135 GGACACACCCACACCAGGACAGG - Intronic
1125485449 15:40108240-40108262 ACACACACACACCCCAGACCTGG + Exonic
1127637076 15:60881306-60881328 AGAGAGACCCTCATCAGGCCAGG + Intronic
1127754839 15:62081968-62081990 AGATGCTCTCACCCCAGGCCTGG - Intergenic
1128429542 15:67577856-67577878 ACAGGCACCCACCACTGGCCCGG - Intronic
1128786848 15:70403968-70403990 GGACACACCTCCCCCAGGCCAGG + Intergenic
1129111276 15:73338783-73338805 GAAGACAGCAACCCCAGGCCTGG + Intronic
1129153470 15:73703403-73703425 AGAGTCACCTGCCCCAGGCCTGG + Intronic
1129350360 15:74952430-74952452 AGAGAAATCCACTGCAGGCCGGG + Intergenic
1129381389 15:75169672-75169694 AGAGCCAACCACCCCCTGCCAGG - Intergenic
1129616676 15:77104395-77104417 ACACACACACACACCAGGCCAGG + Exonic
1129925411 15:79359372-79359394 ACAGGCACCCACACCATGCCTGG + Intronic
1132622812 16:875757-875779 AGAGATGCCCACGCCAGGCTCGG - Intronic
1132685747 16:1161398-1161420 AGAGACAACCACCTCCGGCCAGG - Intronic
1132817914 16:1843149-1843171 ACAGGCGCCCACCCCACGCCCGG - Intronic
1132854460 16:2038638-2038660 AGGGACCCCCACACCAGGGCAGG - Exonic
1132891424 16:2206685-2206707 AGAGCAGCCCACCCCAGCCCCGG - Intronic
1132958662 16:2610267-2610289 GGAGCCACCCACCGCAGGCCAGG - Intergenic
1133001529 16:2853831-2853853 CGAGCCCCCCACCCCTGGCCAGG - Intronic
1133143861 16:3769162-3769184 AGCGGCACCCACCTCAGACCTGG + Exonic
1133983754 16:10652553-10652575 ACACACACCCCCTCCAGGCCAGG + Intronic
1134606496 16:15575475-15575497 GGAGACCCCCACCCCAAGCATGG - Intronic
1136010287 16:27359193-27359215 AGAGAAGCCCACCCCAGGCTGGG - Intronic
1136186486 16:28591536-28591558 AGAGACCCCCAGGCCAGGACAGG - Intronic
1136694263 16:32062642-32062664 ACCCACACCAACCCCAGGCCTGG - Intergenic
1136794760 16:33005906-33005928 ACCCACACCAACCCCAGGCCTGG - Intergenic
1136875145 16:33848486-33848508 ACCCACACCAACCCCAGGCCTGG + Intergenic
1136911158 16:34145703-34145725 ACAGGCGCCCACACCAGGCCTGG + Intergenic
1137002791 16:35245970-35245992 AGAGAAGCCCACCCCTTGCCTGG - Intergenic
1137517129 16:49156216-49156238 AGAAACACCCACCCCAGGAAAGG + Intergenic
1138120973 16:54400856-54400878 ATAGAAACTCACCCTAGGCCAGG + Intergenic
1138434257 16:56988618-56988640 ACCCACACCCACCCCAGGCCTGG + Intergenic
1139353520 16:66353023-66353045 ACAGCCACCCACCCCACCCCTGG - Intergenic
1139833852 16:69822518-69822540 ACACACACCCCACCCAGGCCAGG - Intronic
1142149081 16:88504873-88504895 AGACACCCCCTCCCCAGGACAGG + Intronic
1142155017 16:88528983-88529005 TGAGTCACTCACCCCCGGCCGGG + Intronic
1203097023 16_KI270728v1_random:1267556-1267578 ACCCACACCAACCCCAGGCCTGG - Intergenic
1142562297 17:817525-817547 ACAGGCACCCACCACACGCCCGG - Intronic
1142605331 17:1078202-1078224 AGAGACCCCCAGCCGAGGTCTGG - Intronic
1143255958 17:5558230-5558252 AGCCACCCCCACCCCCGGCCAGG + Intronic
1143617990 17:8064800-8064822 AGATGCTCCCACCCCAGGTCTGG + Intergenic
1143774130 17:9186572-9186594 AGCCACTCCCACCCCAGGCTGGG - Intronic
1143959543 17:10704058-10704080 AGAGACACCACACCCAGCCCTGG - Intronic
1144804882 17:17958309-17958331 AGAGAAACCAATCCCAGGCTAGG - Intronic
1146858067 17:36271787-36271809 ACAGGCACGCACCACAGGCCTGG + Intronic
1147076942 17:37996760-37996782 ACAGGCACGCACCACAGGCCTGG - Intronic
1147088387 17:38075845-38075867 ACAGGCACGCACCACAGGCCTGG + Intergenic
1147108823 17:38244676-38244698 ACAGGCACGCACCACAGGCCTGG - Intergenic
1147286289 17:39404806-39404828 AGAGTCACCAACCTCAAGCCTGG + Intronic
1147450820 17:40502762-40502784 AGTGACATCCACTCCAGGGCAGG - Intergenic
1148476719 17:47933546-47933568 AGGGCCACCTACCCCATGCCAGG + Intergenic
1148808325 17:50275206-50275228 ATAAACACCCATCCCAGGACCGG - Intronic
1148813012 17:50306752-50306774 ACAGAAACCCAACTCAGGCCGGG + Intergenic
1150230207 17:63545570-63545592 AGAGGGATGCACCCCAGGCCAGG - Intronic
1150423417 17:65057562-65057584 AGAGCCACCAGGCCCAGGCCTGG + Intergenic
1150549664 17:66197668-66197690 AGACACACCTCGCCCAGGCCTGG - Intergenic
1150733425 17:67715592-67715614 AGAGGCACCCACCCCACACCTGG - Intergenic
1151251982 17:72843242-72843264 AAAGAACCCCTCCCCAGGCCGGG - Intronic
1151457036 17:74232512-74232534 AGGGACAGCCAGCTCAGGCCTGG + Intronic
1151534429 17:74730661-74730683 GGCGTCACCCACCCCAGCCCAGG + Intronic
1151619854 17:75239122-75239144 AGAGACACCCAACAGAGCCCCGG + Intronic
1152214668 17:79025142-79025164 AGAGGCTCCAGCCCCAGGCCGGG - Intronic
1152253279 17:79222841-79222863 AGAGCAACCCAGCCCATGCCCGG - Intronic
1152319665 17:79601325-79601347 AGAGACACCCACCCTAAGAGAGG - Intergenic
1152406783 17:80102294-80102316 AGAGACAGTCACCCCTGGCCTGG - Intergenic
1152541456 17:80978774-80978796 AGAGCCGCCCTCCCCAGGCACGG + Intergenic
1152934473 17:83127971-83127993 AGAGACACCAACTCCTGGCCTGG - Intergenic
1153372395 18:4333941-4333963 AAAGACCCACACCTCAGGCCAGG + Intronic
1153725954 18:7955349-7955371 AGTGCCACCCTCCCCTGGCCTGG - Exonic
1154294843 18:13138754-13138776 ACAGGCACCCACACCAGGGCAGG - Intergenic
1154306700 18:13235777-13235799 AAAGCAACCCACCCCAGGGCTGG - Intronic
1156514109 18:37665527-37665549 AGAGACTCCCAGCCCAGGTGGGG + Intergenic
1157196734 18:45625883-45625905 AGAGGCAGCCAGACCAGGCCAGG + Intronic
1157404032 18:47408777-47408799 ACAGACACCCTCCTCTGGCCAGG - Intergenic
1158139967 18:54244945-54244967 CAAAACACCCACCTCAGGCCGGG - Intergenic
1159643820 18:70894034-70894056 TGAGCCACCCTGCCCAGGCCAGG - Intergenic
1160028193 18:75236208-75236230 TGAGACACACACCCCTGGTCAGG - Intronic
1160490772 18:79335298-79335320 AGTGACACACATCCCAGTCCTGG - Intronic
1160736065 19:662966-662988 AGCGACCCCCACCCCGGCCCCGG + Intronic
1160745904 19:710482-710504 AGCCACACCCTGCCCAGGCCTGG - Intronic
1161123371 19:2542409-2542431 GAAAAAACCCACCCCAGGCCAGG - Intronic
1161242082 19:3228309-3228331 AAGGACCCCCACCCCAGGCCAGG + Intronic
1161524850 19:4747685-4747707 AGAGTAAGACACCCCAGGCCAGG - Intergenic
1161589994 19:5125248-5125270 AGCCACACCCTCCCCAGCCCCGG + Intronic
1163249239 19:16116527-16116549 AAAGACACCAACCCAAGGCCAGG + Intronic
1163666068 19:18604654-18604676 AGATGCACGCACTCCAGGCCAGG + Intronic
1163700051 19:18782443-18782465 ACACACACACACCCCAGACCAGG + Intergenic
1163721106 19:18898649-18898671 AGCGACCCCCACCCCCAGCCTGG - Intergenic
1164137468 19:22427667-22427689 AGACACCCCCACCCCCAGCCTGG - Intronic
1164370120 19:27636639-27636661 AGAGACACCCAGCCAACCCCAGG - Intergenic
1164376519 19:27692585-27692607 AGAGACTCCCACCCAATCCCAGG - Intergenic
1165487266 19:36103422-36103444 ATCTGCACCCACCCCAGGCCTGG + Exonic
1165589324 19:36953767-36953789 ACAGGCACCCGCCCCATGCCTGG - Intronic
1165594464 19:37000441-37000463 ACAGTCGCCCACCACAGGCCTGG - Intergenic
1165779801 19:38425789-38425811 AGAGACACTCAGCCCAGGCCAGG + Intronic
1166073210 19:40398423-40398445 GGACAGACCCACCCCAGCCCAGG - Intronic
1166081452 19:40446227-40446249 AGGGACACCTTCCCTAGGCCTGG - Intergenic
1167116310 19:47491166-47491188 AGAAGCACCAGCCCCAGGCCTGG - Intronic
1168650974 19:58091907-58091929 AGAGTAAACCACACCAGGCCAGG + Intronic
925316791 2:2932704-2932726 AGAGACATCCTCTCGAGGCCTGG - Intergenic
925844160 2:8020560-8020582 AGAGTCCTCCAGCCCAGGCCCGG + Intergenic
926149169 2:10415213-10415235 AGGCACACCCAGCCCAGGGCCGG - Intronic
928065914 2:28164341-28164363 AGAGAGACCTATTCCAGGCCAGG - Intronic
928335277 2:30392785-30392807 ATAGGCACCCACCCCATACCAGG + Intergenic
929002593 2:37362872-37362894 AGAGATTCCCACCCCACACCAGG + Intronic
929537729 2:42793723-42793745 TGAGAAAACCAGCCCAGGCCAGG - Intergenic
929688698 2:44056902-44056924 AGAGAGACCCACCTCTGGGCCGG - Intergenic
930703750 2:54484754-54484776 CGACACAACCACCCCACGCCGGG - Intronic
931006040 2:57850577-57850599 AGAGGCACCCACCCCTGGGCAGG - Intergenic
932405142 2:71507739-71507761 ACAAACACCCCCCACAGGCCTGG + Intronic
932405904 2:71512564-71512586 AGAGCCAGCCACCCCGGGCTGGG - Intronic
932871909 2:75409617-75409639 ACAGACACAGACTCCAGGCCTGG + Intergenic
933035707 2:77394831-77394853 AGAGACCACCAACCCTGGCCTGG - Intronic
933724325 2:85418176-85418198 TGGGAGACCCAGCCCAGGCCTGG - Intronic
934034352 2:88076708-88076730 TAAGACACCTACCCCAGGCTGGG + Intronic
934095309 2:88596598-88596620 AGAGTTAACCACGCCAGGCCAGG + Intronic
934176367 2:89582790-89582812 AGAGGCCCCCACCCCACCCCAGG - Intergenic
934286677 2:91657151-91657173 AGAGGCCCCCACCCCACCCCAGG - Intergenic
935291073 2:101611532-101611554 AGAGATACTGATCCCAGGCCGGG + Intergenic
936433156 2:112481920-112481942 GGAAAGAACCACCCCAGGCCCGG + Intergenic
936789385 2:116133075-116133097 TGAGCCACCCGCGCCAGGCCGGG + Intergenic
937288924 2:120770265-120770287 AGAGACAGCCAGGCAAGGCCTGG - Intronic
937618828 2:123961325-123961347 GGAGTCAGCCACTCCAGGCCTGG + Intergenic
938964556 2:136376818-136376840 AGAGACTCAAACCCCAGGTCTGG + Intergenic
939551421 2:143620250-143620272 TGAAACACCCACTCCAGGACTGG - Intronic
946926533 2:224632316-224632338 ACAGACACGCACCACAGACCCGG - Intergenic
947243309 2:228019426-228019448 AGAGACTTCCATCTCAGGCCAGG + Exonic
947557862 2:231113020-231113042 ACAGACACACCCCCCATGCCTGG - Intronic
947586615 2:231360644-231360666 AAAAGCACGCACCCCAGGCCAGG - Intronic
947929534 2:233952372-233952394 AGAAAGCCCCACACCAGGCCAGG - Intronic
948462375 2:238136364-238136386 AGACCCTCCCGCCCCAGGCCAGG - Intergenic
948583279 2:239002726-239002748 AGAGACCCCCACCCCAGAGAGGG - Intergenic
948627767 2:239279711-239279733 AGAACCAGCCACACCAGGCCAGG + Intronic
948845690 2:240681877-240681899 AGGGACTCCCACACCAGACCAGG + Intronic
948848165 2:240692853-240692875 AGGGACTCCCACACCAGACCAGG - Intronic
948852604 2:240715703-240715725 AGAGACCCCAATCCCATGCCTGG - Exonic
949040878 2:241849553-241849575 AGGGACACCCATGCCTGGCCAGG + Intergenic
949041686 2:241852560-241852582 GGGGACACCCACCCCAGGACCGG + Intronic
1168834420 20:868625-868647 AGAGACAACCACCACAGGTGAGG - Intergenic
1168853771 20:994471-994493 AGAGGCACCCAGCCCTGGGCTGG + Intronic
1170572137 20:17638406-17638428 GGAGACACCCTTCCCAGCCCTGG + Intronic
1170876574 20:20255282-20255304 AGAGATGCCTTCCCCAGGCCTGG + Intronic
1171906505 20:30903966-30903988 ACAGGCGCCCACACCAGGCCCGG + Intergenic
1174225019 20:48991188-48991210 AGAGACACGTACCTCATGCCAGG - Exonic
1174483091 20:50844874-50844896 TGACTCACCCACCCCTGGCCAGG - Intronic
1174765243 20:53247426-53247448 AGAGGCCCTCACTCCAGGCCTGG + Intronic
1175997423 20:62817859-62817881 AGAGACACACACCTCAGTGCCGG - Intronic
1176110405 20:63408216-63408238 TGAGCCTCCCACCCCCGGCCTGG - Intronic
1176205949 20:63888207-63888229 ACAGATACCCCTCCCAGGCCCGG - Intronic
1176841380 21:13845960-13845982 AGAGTCACCCACCCAAAGCAAGG + Intergenic
1177608934 21:23420884-23420906 ACAGGCACCCACCCTACGCCTGG + Intergenic
1180065424 21:45409862-45409884 GGAGACAGCCAGCCCAGGCAGGG + Intronic
1180246011 21:46547809-46547831 ACAGACATGCACCCCACGCCTGG + Intronic
1180339917 22:11610085-11610107 ACAGGCGCCCACACCAGGCCCGG + Intergenic
1180631955 22:17235923-17235945 AGGGAGACCCAACCCAGGGCAGG + Intergenic
1181579828 22:23821996-23822018 AGAAACACCCAGCTCTGGCCAGG - Intronic
1181582674 22:23836851-23836873 AGTGACCCCCACCCAGGGCCAGG - Intronic
1181745080 22:24950564-24950586 AGAGATGCCCAGCCCAGACCGGG - Intergenic
1182130388 22:27845972-27845994 CGAGACACCCTCCTCAGGCAAGG - Intergenic
1182867835 22:33619971-33619993 AGGGTCACCCAGCTCAGGCCTGG + Intronic
1183376519 22:37468454-37468476 AAAAACACACACCACAGGCCGGG + Intergenic
1183412681 22:37664599-37664621 AGAAACACCCAGCACAGGCCAGG + Intronic
1183508765 22:38223203-38223225 AGACATACCCACGCCCGGCCGGG - Intronic
1184124848 22:42479837-42479859 AAAGACCCCCATTCCAGGCCAGG + Intergenic
1184437426 22:44487919-44487941 AGACACACAGACCCCAGTCCAGG - Intergenic
1184667356 22:45996050-45996072 AGAGCCTCTCAGCCCAGGCCTGG - Intergenic
1184687928 22:46104774-46104796 TGAGAGACCCACTCCCGGCCGGG - Intronic
1184767105 22:46577580-46577602 GGCGACCCCCACCCCAGTCCGGG - Intronic
1184827231 22:46960644-46960666 AAAGATACCCAGTCCAGGCCAGG + Intronic
1184980014 22:48089412-48089434 AGAGACAGGCACAGCAGGCCTGG + Intergenic
1185137059 22:49079151-49079173 TGAGGCACCCACACCAGGCAGGG - Intergenic
1185142975 22:49113517-49113539 TGAGCCACTCGCCCCAGGCCTGG - Intergenic
1185198651 22:49489213-49489235 TTAGACACACACCCCATGCCTGG + Intronic
1185367835 22:50445127-50445149 AGACTCTCCCACCCCTGGCCGGG - Exonic
950435719 3:12978561-12978583 ACAGGCACCCGCCCCACGCCCGG - Intronic
950660965 3:14466802-14466824 AGGCACACCCGCCACAGGCCCGG - Intronic
950678037 3:14566325-14566347 AGAGTCACACACCACAGGACTGG + Intergenic
950938279 3:16866003-16866025 AGAGTCACCTCCCCCAGGTCAGG + Intronic
953288832 3:41641399-41641421 AGAAACAGCTACACCAGGCCAGG + Intronic
954170400 3:48797452-48797474 AGAGACACTCACTGCAGTCCTGG + Intronic
956723448 3:72138085-72138107 GGAGACATCCACGCCAGCCCTGG - Intergenic
959653645 3:108776358-108776380 AGAGACACCCAACCCAGTGGGGG + Intergenic
960105220 3:113788474-113788496 ACAGGCACCCACCACATGCCCGG + Intronic
961713575 3:128844719-128844741 GGAGGCGCCCTCCCCAGGCCTGG - Intergenic
962156941 3:132957467-132957489 AGGGACACCCACCAGATGCCAGG - Intergenic
962266095 3:133945339-133945361 ACAGACACACTCACCAGGCCAGG - Intronic
963874256 3:150456325-150456347 ACAGGCACCCGCCCCAAGCCTGG + Intronic
967853142 3:194097219-194097241 ACACACACACACACCAGGCCTGG - Intergenic
968089876 3:195893202-195893224 GGAGACACCCAGCCAAGGCTGGG - Intronic
968554974 4:1242254-1242276 AGTGACACCCTCCCGAGGGCTGG - Intronic
968658152 4:1787401-1787423 AGAGCCCCCTGCCCCAGGCCAGG - Intergenic
968698025 4:2042191-2042213 GGACCCACCCACCCCGGGCCCGG - Intronic
968734546 4:2288542-2288564 GGAGACACCCTCCCCATGGCAGG - Intronic
969185255 4:5469681-5469703 ACAGACACACACACCAGGCTTGG + Intronic
969676288 4:8616246-8616268 GTAGACTCCCACCCGAGGCCTGG - Intronic
970609424 4:17711334-17711356 ACAGGCACCCACCCCACGCCCGG - Intronic
972734000 4:41822425-41822447 AGAGACACAGACACCAGGCGGGG - Intergenic
975394361 4:73857464-73857486 CGAGACTCCAACCCCAGGTCAGG - Intergenic
978471254 4:109070114-109070136 AGAGGCATACACCCCATGCCCGG - Intronic
980945228 4:139313187-139313209 GGAGACAACCAACCAAGGCCAGG - Intronic
983263105 4:165477769-165477791 AAGCACACACACCCCAGGCCTGG - Intronic
986266819 5:6197819-6197841 AGAGCCACCCCACCCATGCCAGG + Intergenic
986336194 5:6757847-6757869 AGAGGTACCCACCCCATGCCCGG + Intergenic
986637576 5:9838074-9838096 AGAGACAACCCCCCCAGGGCAGG + Intergenic
987847517 5:23305273-23305295 ACAGACCCCCTCTCCAGGCCTGG + Intergenic
988093036 5:26567760-26567782 AGAGACACCCACTCCACACCAGG - Intergenic
988597279 5:32606694-32606716 ACAGGCGCCCACACCAGGCCCGG + Intergenic
988698167 5:33645023-33645045 AGATAAAGCCACCCTAGGCCGGG - Intronic
990954899 5:61331879-61331901 AGACCCACCCACCTCAGGCCCGG + Intergenic
992851031 5:80807802-80807824 ACAGATACCCACCTCAGACCGGG + Intronic
993492367 5:88567905-88567927 AGAGACACCAAACCTAGACCTGG - Intergenic
995724180 5:115167235-115167257 AGAGAGCCCCATCACAGGCCTGG - Intronic
995759871 5:115551763-115551785 TGAGGCACTCTCCCCAGGCCTGG - Intergenic
996319362 5:122197111-122197133 AGAGCCACCCAACCCACACCAGG + Intergenic
997875867 5:137546295-137546317 AGAGACACCCACCTCAAATCTGG - Intronic
998140509 5:139697194-139697216 AGAGACCCCCACCCCGCCCCAGG - Intergenic
998446161 5:142200043-142200065 ATAGAAACCCACTCTAGGCCGGG - Intergenic
999440089 5:151594275-151594297 AGAGAGGCACACGCCAGGCCAGG - Intergenic
999889998 5:155967219-155967241 AGAGACACCCATCACAGGCAAGG - Intronic
1000041178 5:157486370-157486392 AGAGACACCCACCTGGGACCCGG + Intronic
1000405329 5:160881667-160881689 ACAGGCGCCCACCCCACGCCCGG - Intergenic
1001319550 5:170668988-170669010 AGGGACACCCAGCCCAGCCTGGG - Intronic
1001400907 5:171445957-171445979 AGAGAGACACCACCCAGGCCAGG - Intronic
1001772247 5:174305303-174305325 AGTTGCACCAACCCCAGGCCGGG + Intergenic
1001915502 5:175556987-175557009 AGGGACACCGGCCCCAGGTCAGG + Intergenic
1002093488 5:176817838-176817860 CGCGGCACCCACCCCCGGCCTGG - Intronic
1002346962 5:178554787-178554809 AGAGGCACCTGCCCCAAGCCAGG + Intronic
1003134333 6:3422376-3422398 AGAAACACCCTCCACAAGCCAGG + Intronic
1003283739 6:4716104-4716126 ACAGGCACCCACACCACGCCAGG - Intronic
1005648840 6:27867487-27867509 CGAGACAGCCACCCCAGCGCCGG - Exonic
1006236356 6:32636798-32636820 AGAAATGCCCACCCCTGGCCAGG + Intronic
1006910719 6:37561774-37561796 AGAGACACACAGCCCAGCCCAGG + Intergenic
1006910930 6:37563236-37563258 AGAGACACACAGCCCAGCCCAGG - Intergenic
1008036375 6:46749450-46749472 AGAAAGATCCACCCCAGGCAAGG + Intronic
1010005767 6:70993173-70993195 ACAGGCACCCACCACACGCCCGG - Intergenic
1012484167 6:99702435-99702457 GGAGATACCCACCCCGTGCCTGG + Intergenic
1013455126 6:110323428-110323450 AAAGCCACCCTCCCCAGCCCTGG - Intronic
1013482383 6:110563695-110563717 TGTCACCCCCACCCCAGGCCTGG + Intergenic
1013970197 6:116008705-116008727 AAGGGCACACACCCCAGGCCCGG + Intronic
1016321383 6:142849812-142849834 ACAGAAACCCACTCTAGGCCAGG - Intronic
1016907600 6:149167122-149167144 AGGGACACCTGGCCCAGGCCAGG - Intergenic
1017359765 6:153554044-153554066 AGTCACACCCACCCTGGGCCTGG - Intergenic
1017707621 6:157138375-157138397 ACAGACATGCACCCCACGCCGGG + Intronic
1018053898 6:160035439-160035461 AGAGACAGGCACCCCTGCCCTGG + Intronic
1018202051 6:161404087-161404109 AGAAACAGCAAACCCAGGCCTGG - Intronic
1018838233 6:167501040-167501062 AGAGTCACCCACACTAGCCCTGG + Intergenic
1018852305 6:167649476-167649498 ACAGCCACCTGCCCCAGGCCAGG - Intergenic
1018901709 6:168054872-168054894 AGACACACCCAGCCGGGGCCGGG - Intergenic
1019263051 7:93095-93117 AGGGCCACCCACACCAGGCACGG + Intergenic
1019562032 7:1664207-1664229 GAAGAGACCCCCCCCAGGCCGGG + Intergenic
1019564184 7:1671432-1671454 AGAGGCAGCCAGCCCAAGCCAGG - Intergenic
1019594545 7:1852342-1852364 AGAGACACCAGCCCCAAGCCAGG - Intronic
1019766725 7:2856927-2856949 AGACACACACACAGCAGGCCTGG + Intergenic
1020268861 7:6579991-6580013 ATAGGCACGCACCCCATGCCTGG - Intronic
1020849744 7:13336896-13336918 AGAAACACCAACAACAGGCCAGG - Intergenic
1021073713 7:16274340-16274362 AGAAACAGCCACAACAGGCCGGG - Intronic
1021714302 7:23447481-23447503 ACAGGCACACACCCCATGCCTGG - Intronic
1022666644 7:32416981-32417003 ATAAACACCCACCCCATGCCTGG + Intergenic
1023052613 7:36266382-36266404 AGAGGCAGCCTCCCCAGGGCAGG + Intronic
1023886067 7:44357508-44357530 ACAGGCACCCACACCACGCCCGG + Intergenic
1026240798 7:68573558-68573580 TGAGACACCAACTCCAGGGCAGG + Intergenic
1029121218 7:98269659-98269681 AGAGACCCCCACCTCAGGCTGGG - Intronic
1029609596 7:101619592-101619614 AGAGACGTCCACCAGAGGCCGGG + Intronic
1029698575 7:102231000-102231022 ACAGGCACACACCCCAAGCCCGG + Intronic
1030525464 7:110648064-110648086 AGTGACACCCACCCCACCCAAGG + Intergenic
1032405430 7:131652378-131652400 AGAGAAGCCCCCCCAAGGCCAGG + Intergenic
1033345100 7:140520338-140520360 ACAGACACCCCTCCCAAGCCAGG - Intronic
1033545021 7:142391905-142391927 AGAGACACCAGCCCCAAGCTAGG + Intergenic
1034983888 7:155495921-155495943 GGAGACACACTCCCTAGGCCCGG + Intronic
1035033689 7:155881573-155881595 GGAGACCACCACACCAGGCCCGG - Intergenic
1035191858 7:157176808-157176830 AGAGAAAACAGCCCCAGGCCTGG - Intronic
1036667205 8:10754949-10754971 AGGGACATCCAGCCCAGACCAGG + Intronic
1036803495 8:11810381-11810403 ACAGACACCGCCCCCATGCCAGG - Intronic
1037360467 8:18068702-18068724 AGAGACACCCACCCCAGGCCGGG + Intronic
1037360481 8:18068775-18068797 AGAGACACCCACCCCAGGCCGGG + Intronic
1037360494 8:18068828-18068850 AGAAATATCCAACCCAGGCCGGG + Intronic
1038015808 8:23513771-23513793 GCAGGCACACACCCCAGGCCCGG + Intergenic
1039035205 8:33352042-33352064 ACACACAGCCATCCCAGGCCTGG - Intergenic
1039603498 8:38861981-38862003 ACAGACACCCCCGCCATGCCCGG - Intergenic
1040488379 8:47896350-47896372 ACAGAACTCCACCCCAGGCCAGG + Intronic
1041337234 8:56800223-56800245 GGAGAAACCTACCCCAGCCCAGG + Intergenic
1042357654 8:67846754-67846776 AGAGCCACCCTGCCCAGGTCAGG - Intergenic
1042515542 8:69655077-69655099 ATAGACACTTACCCCAGGCTGGG - Intronic
1043510048 8:80941471-80941493 ACTGACACCCACCACAGGCCTGG - Intergenic
1043527403 8:81111873-81111895 AGAGACACCCACCAGGGGCTCGG - Exonic
1043974661 8:86570957-86570979 TGAAAAACCCACCCCTGGCCAGG - Intronic
1044119009 8:88370914-88370936 ACACACACCCACCCATGGCCAGG - Intergenic
1044820435 8:96152606-96152628 AGTGACAAGCACCACAGGCCTGG - Intronic
1045188782 8:99863491-99863513 AGAGAGACCCACCCCTGGGCTGG + Intronic
1045576604 8:103428502-103428524 AGAGACAGACACTCCAGACCAGG - Intronic
1047596413 8:126382060-126382082 AGAGACTCCCAGACCAGGCAGGG + Intergenic
1048525386 8:135197682-135197704 AGAGACAACCACCACTGGCTTGG + Intergenic
1049024367 8:139978770-139978792 AGCCACACCCGCCTCAGGCCTGG - Intronic
1049374181 8:142281266-142281288 AGAGACACCCAGCCAGAGCCAGG + Intronic
1049551352 8:143261402-143261424 AGAGACACCCTGCCCTGCCCCGG - Intronic
1049618869 8:143588922-143588944 AGGGACAGCCATCCCAGGCTGGG - Intronic
1050966424 9:11809813-11809835 ACAGGCACCCGCCCCAAGCCCGG + Intergenic
1051780654 9:20684736-20684758 GGAGACAGTCACCCCAGGCCAGG - Intronic
1052813905 9:33085104-33085126 ACAGGCACCCACACCACGCCCGG - Intergenic
1053009572 9:34625476-34625498 GGACCCTCCCACCCCAGGCCAGG + Intronic
1056592377 9:87974120-87974142 AGAGACACGCGCCCCCGGCTCGG + Intronic
1057605816 9:96497043-96497065 AGAGAAACACACCCAGGGCCAGG + Intronic
1057757167 9:97847932-97847954 AGAGACTTGCACTCCAGGCCCGG + Intergenic
1060588008 9:124798690-124798712 ACAGGCACCCACCACATGCCCGG - Intronic
1060658079 9:125386637-125386659 TAAGAAACCCACTCCAGGCCAGG + Intergenic
1061200943 9:129138208-129138230 AGTGACTGCCACCACAGGCCAGG - Intronic
1061203127 9:129148524-129148546 AGAGACAGCCTCCCAAGCCCAGG + Exonic
1061971312 9:134046977-134046999 AGACACACAAACCCCAGCCCTGG + Intronic
1062027861 9:134348826-134348848 AGGGACTGCAACCCCAGGCCCGG - Intronic
1062289304 9:135787395-135787417 AGTGACACCCACCCCTGAGCCGG + Intronic
1062378327 9:136274975-136274997 AGAGACACTCGACCCAGGCCAGG - Intergenic
1190502934 X:51097201-51097223 AGAGACACACACCAAAGGGCAGG - Intergenic
1190877891 X:54472590-54472612 AGGGACCCCCACCCCAGGGATGG + Intronic
1191232372 X:58106188-58106210 AGAGACACCTGCCCCAATCCAGG + Intergenic
1191254026 X:58272118-58272140 ACAGACACCCACCCCGGGTGGGG + Intergenic
1191255721 X:58278767-58278789 AAAGACATGCACCCCAGGTCGGG + Intergenic
1191603208 X:63032896-63032918 AGAAACACACACCCTATGCCTGG - Intergenic
1192169087 X:68843358-68843380 AGAGACCCCCAGCCCAGGCCGGG - Intergenic
1192525204 X:71837075-71837097 ACAGGCACCCAACCCAAGCCTGG + Intergenic
1193379767 X:80805638-80805660 AAAAATACCTACCCCAGGCCGGG + Intronic
1194578521 X:95642184-95642206 AGAGCCTCCCATCACAGGCCTGG - Intergenic
1195625101 X:106999555-106999577 CGAGGCCCCCACCCCAGCCCCGG + Intronic
1197203751 X:123772152-123772174 AGAGATACCCTGCCCTGGCCGGG + Intergenic
1197703928 X:129620242-129620264 AGCAACACTCACCCCAGGCCTGG - Intergenic
1198828082 X:140719792-140719814 AAAGACTCACATCCCAGGCCAGG + Intergenic
1199774788 X:151001190-151001212 ACAAAAACCCACCACAGGCCTGG - Intergenic
1200179235 X:154140453-154140475 AGAGGGACCCAAGCCAGGCCGGG - Intergenic
1200362252 X:155620905-155620927 CTAGACACCCAGCCCATGCCTGG - Intronic