ID: 1037360467 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:18068702-18068724 |
| Sequence | AGAGACACCCACCCCAGGCC GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 455 | |||
| Summary | {0: 2, 1: 0, 2: 4, 3: 38, 4: 411} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1037360461_1037360467 | 7 | Left | 1037360461 | 8:18068672-18068694 | CCTGCAATGCACATGACAGCCCC | 0: 2 1: 37 2: 249 3: 688 4: 1430 |
||
| Right | 1037360467 | 8:18068702-18068724 | AGAGACACCCACCCCAGGCCGGG | 0: 2 1: 0 2: 4 3: 38 4: 411 |
||||
| 1037360460_1037360467 | 27 | Left | 1037360460 | 8:18068652-18068674 | CCAGGGACACTGCTAAACATCCT | 0: 8 1: 68 2: 253 3: 1004 4: 1675 |
||
| Right | 1037360467 | 8:18068702-18068724 | AGAGACACCCACCCCAGGCCGGG | 0: 2 1: 0 2: 4 3: 38 4: 411 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1037360467 | Original CRISPR | AGAGACACCCACCCCAGGCC GGG | Intronic | ||