ID: 1037360475

View in Genome Browser
Species Human (GRCh38)
Location 8:18068745-18068767
Sequence GGGGCTGTCATGTGCATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2406
Summary {0: 2, 1: 37, 2: 249, 3: 688, 4: 1430}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037360475_1037360484 15 Left 1037360475 8:18068745-18068767 CCTGCAATGCACATGACAGCCCC 0: 2
1: 37
2: 249
3: 688
4: 1430
Right 1037360484 8:18068783-18068805 CCACCCCAGGCCGGGCATCCTGG 0: 1
1: 0
2: 1
3: 31
4: 373
1037360475_1037360479 2 Left 1037360475 8:18068745-18068767 CCTGCAATGCACATGACAGCCCC 0: 2
1: 37
2: 249
3: 688
4: 1430
Right 1037360479 8:18068770-18068792 AAAAAAGAGACACCCACCCCAGG 0: 2
1: 0
2: 2
3: 18
4: 291
1037360475_1037360481 7 Left 1037360475 8:18068745-18068767 CCTGCAATGCACATGACAGCCCC 0: 2
1: 37
2: 249
3: 688
4: 1430
Right 1037360481 8:18068775-18068797 AGAGACACCCACCCCAGGCCGGG 0: 2
1: 0
2: 4
3: 38
4: 411
1037360475_1037360480 6 Left 1037360475 8:18068745-18068767 CCTGCAATGCACATGACAGCCCC 0: 2
1: 37
2: 249
3: 688
4: 1430
Right 1037360480 8:18068774-18068796 AAGAGACACCCACCCCAGGCCGG 0: 2
1: 0
2: 2
3: 29
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037360475 Original CRISPR GGGGCTGTCATGTGCATTGC AGG (reversed) Intronic
Too many off-targets to display for this crispr