ID: 1037360479

View in Genome Browser
Species Human (GRCh38)
Location 8:18068770-18068792
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 2, 1: 0, 2: 2, 3: 18, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037360475_1037360479 2 Left 1037360475 8:18068745-18068767 CCTGCAATGCACATGACAGCCCC 0: 2
1: 37
2: 249
3: 688
4: 1430
Right 1037360479 8:18068770-18068792 AAAAAAGAGACACCCACCCCAGG 0: 2
1: 0
2: 2
3: 18
4: 291
1037360473_1037360479 27 Left 1037360473 8:18068720-18068742 CCGGGCATCCTGAGCTGCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1037360479 8:18068770-18068792 AAAAAAGAGACACCCACCCCAGG 0: 2
1: 0
2: 2
3: 18
4: 291
1037360474_1037360479 19 Left 1037360474 8:18068728-18068750 CCTGAGCTGCTAAACATCCTGCA 0: 1
1: 1
2: 5
3: 39
4: 170
Right 1037360479 8:18068770-18068792 AAAAAAGAGACACCCACCCCAGG 0: 2
1: 0
2: 2
3: 18
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900399365 1:2466704-2466726 ACAAAAGAGACGTCCACCCATGG - Intronic
900399439 1:2467033-2467055 CAAGAAGAGCCACTCACCCCAGG - Intronic
901702998 1:11055407-11055429 AAAAAAAAAAAACCCTCCCCAGG - Intronic
901851411 1:12018474-12018496 AAAAAAAAGATACCCAGCCTGGG - Intergenic
902133592 1:14284865-14284887 AAAACAGAGAGACCCATCTCTGG - Intergenic
902360463 1:15939674-15939696 AGGAAAGAGAAACCCAGCCCCGG - Exonic
903003624 1:20283950-20283972 TAAATAATGACACCCACCCCTGG - Intergenic
903486998 1:23697159-23697181 AAAAAAAAGACAATCACCACAGG - Intergenic
905078283 1:35293611-35293633 AAAAAAGAAAAACCCACAGCCGG - Intronic
905106893 1:35568904-35568926 AATAAAGTGACAGCCACCCATGG + Intergenic
905393827 1:37654612-37654634 AAAAAAGAGAAACCACCTCCTGG - Intergenic
906448218 1:45922067-45922089 AGAAAGGAGCCACCCACTCCAGG - Intronic
906622035 1:47290206-47290228 AGAAAAGATTCACCCACTCCAGG - Intronic
906964460 1:50442842-50442864 TAAAAAGACACATCCGCCCCTGG + Intronic
907153003 1:52306411-52306433 AGAGAGGAGCCACCCACCCCAGG + Intronic
909537767 1:76757398-76757420 AAAAAAGAAAAATCCACCCAAGG - Intergenic
910277962 1:85468356-85468378 AATAAAGACACACCCAAGCCTGG + Intronic
911514747 1:98853928-98853950 AAAAATGAGACTCCCAGGCCAGG - Intergenic
911813607 1:102314004-102314026 AAACAAGAGACACCCAGCAATGG - Intergenic
912029573 1:105222763-105222785 AAACAAGAGACACTCACCTAAGG - Intergenic
914829447 1:151160014-151160036 AACAAAGAGACTCCCACAACTGG + Exonic
915225692 1:154409722-154409744 ATAAAAGAGACAAAAACCCCAGG + Intronic
915797356 1:158751639-158751661 AAAAAAGAGACTCCCTGGCCGGG + Intergenic
916171455 1:162004200-162004222 AAATAAGAGACACTGAGCCCAGG + Intronic
916188361 1:162154763-162154785 AAAAAAGAGACATCAGTCCCTGG - Intronic
916416363 1:164595829-164595851 CAGAAAGAGACACCCAGCCTGGG + Intronic
916511210 1:165473835-165473857 CAAAAAGAGACAGCTAACCCTGG + Intergenic
917236967 1:172904273-172904295 AAAAAGGAGAAACCTACTCCAGG - Intergenic
920579475 1:207091894-207091916 AAAAAAGAGAAAAGCATCCCAGG - Intronic
920792242 1:209104248-209104270 AAACAAGGGACACCTACCCAGGG - Intergenic
921940307 1:220832080-220832102 AAAAAAGAGACACCTAGCCCAGG - Intergenic
922083022 1:222316296-222316318 AAAAAAAAGACACAGACCTCAGG + Intergenic
922248644 1:223825981-223826003 AAAAAAAAGACACTCAGCACAGG + Intronic
923184009 1:231551998-231552020 AAAAAAGAAAGACCCATTCCAGG + Intronic
923641176 1:235762587-235762609 TAACAAGAGACACCCAGCACAGG - Intronic
1063017868 10:2096331-2096353 AAAAAAGAAATGCCCAACCCAGG - Intergenic
1063359141 10:5435087-5435109 AAAACAGAGATACTCAACCCTGG + Intronic
1063570553 10:7211146-7211168 AAAAGATAGCCGCCCACCCCAGG - Intronic
1063599979 10:7472167-7472189 AAAAAAGAGACTCCTTCCCAAGG + Intergenic
1065246062 10:23758931-23758953 TAAATAGAAAAACCCACCCCAGG - Intronic
1065517595 10:26539953-26539975 GAAAAAGAGACACTCACGCCTGG + Intronic
1066270707 10:33820115-33820137 AAAAAACAAACCCCCACCCCCGG - Intergenic
1067124067 10:43500438-43500460 AAAAAACAACCCCCCACCCCTGG + Intergenic
1071328418 10:84538902-84538924 TCAAAAGAGACACCCACTTCAGG - Intergenic
1071404614 10:85318053-85318075 GGAAGAGAGCCACCCACCCCGGG - Intergenic
1072363814 10:94688269-94688291 AAAAAAAAGTCACCCACCATTGG - Exonic
1075792721 10:125096683-125096705 AAAAAAAAGCCAGCCAGCCCAGG + Intronic
1075943360 10:126410210-126410232 CAAAAAGAGACACGATCCCCAGG - Intergenic
1076009288 10:126974468-126974490 AAAAAAGAGACATCCACCCAGGG - Intronic
1076177846 10:128382415-128382437 ATAACAGAGACACCCTCCCCAGG + Intergenic
1076190434 10:128479546-128479568 AAAACGGAGCCAGCCACCCCAGG + Intergenic
1076570321 10:131428395-131428417 AAAAAAGAAACAACCATTCCAGG - Intergenic
1077183359 11:1226138-1226160 GAAGCAGAGACACCCTCCCCGGG - Intronic
1078231294 11:9445307-9445329 ACAAAAGAAACAACAACCCCAGG + Exonic
1078294001 11:10046884-10046906 AAAAAAAAAAAACCCATCCCTGG + Intronic
1078408905 11:11095396-11095418 ACACAAGAGACACCCATGCCAGG + Intergenic
1079259664 11:18866179-18866201 AAAGAAGACACACCCTCCTCTGG + Intergenic
1079392741 11:20036430-20036452 AAATAAGAGACACACACTCTGGG - Intronic
1080427904 11:32173173-32173195 AAGAAAGAGCCAGCCACGCCAGG + Intergenic
1081026066 11:38016553-38016575 GAAAAATACTCACCCACCCCAGG + Intergenic
1081914949 11:46724755-46724777 AAAAAAAAAAGACCAACCCCAGG - Intronic
1084456024 11:69268744-69268766 CAGAAAGAGGCCCCCACCCCAGG - Intergenic
1084660790 11:70545139-70545161 CAAAAAGAGACGCCCACGGCAGG - Intronic
1084670299 11:70602931-70602953 ATAAACGAGACACACACACCGGG + Intronic
1084756409 11:71241646-71241668 AAAGATGAGACACCCCCACCAGG + Intronic
1085877776 11:80429547-80429569 AATAAAGAATCACCAACCCCTGG + Intergenic
1087321730 11:96669399-96669421 AAAAAAGACACACCAAGTCCAGG - Intergenic
1087437626 11:98142612-98142634 ACAAAAGAGACACCTATCCTGGG - Intergenic
1090377723 11:126303339-126303361 AAAAAAGAGAAACGAAACCCTGG + Intronic
1090841224 11:130488816-130488838 AAAAAACACACACCCTTCCCCGG - Intergenic
1091625145 12:2115783-2115805 AAAAAACAAAAACCCAACCCAGG - Intronic
1093929963 12:24945975-24945997 AAATAACAGATGCCCACCCCAGG - Intronic
1095530699 12:43183240-43183262 AAAAAAGACACACCCAAGACTGG + Intergenic
1096603268 12:52745779-52745801 AAAAAAAAGACACCTGCGCCTGG - Intergenic
1098592422 12:72229167-72229189 AAAAAAGACACACCCAAGACTGG + Intronic
1099448894 12:82784866-82784888 AAAAAAAAGACACACACGCAAGG - Intronic
1100890499 12:99120277-99120299 AAAAAATTGACTCCCAGCCCGGG - Intronic
1102603755 12:114053117-114053139 AATAAAGAGACATCCTCCTCAGG + Intergenic
1102990287 12:117310860-117310882 AAAAAAAAGACAACCAGCCTGGG - Intronic
1103758841 12:123233253-123233275 CAAAGAGAGACATCCAACCCCGG + Exonic
1104070256 12:125338525-125338547 GAAGATGAGACACCCACTCCAGG - Intronic
1104450679 12:128866051-128866073 AAAAAAGGTACAATCACCCCTGG - Intronic
1104751148 12:131239948-131239970 AAGAGAGAAACACCCTCCCCGGG - Intergenic
1105825825 13:24121930-24121952 ACAAAAGAAACAACAACCCCAGG - Intronic
1106974714 13:35195896-35195918 GAAAAAGAAACACCAACTCCTGG + Exonic
1110455089 13:75682448-75682470 AAAAAAGAGGCACCCCATCCAGG - Intronic
1111564952 13:90002122-90002144 TACAAACAGACCCCCACCCCAGG - Intergenic
1118750211 14:68801609-68801631 AAAATAAAGAAACCCACACCAGG - Intergenic
1118856661 14:69628709-69628731 AAAAAAAAAAAACCCACCACAGG - Intronic
1119179782 14:72598006-72598028 AAATAACAGACACCCACTCAAGG - Intergenic
1119353723 14:73988229-73988251 AAAGAAGAAACACTCACTCCTGG + Intronic
1119445143 14:74657181-74657203 AAAACAGAGTCACCACCCCCTGG + Intronic
1119531664 14:75365800-75365822 AAAACACAGACACCTACACCAGG - Intergenic
1119677858 14:76569335-76569357 AACAAAGAGATGCCCAGCCCAGG + Intergenic
1119781693 14:77280247-77280269 AAAACAGATACTCCCACCTCTGG + Intronic
1120626525 14:86833367-86833389 AAAAAAGAGACTGCCAGCCAAGG + Intergenic
1121115901 14:91342547-91342569 CAAAAGGAACCACCCACCCCGGG + Intronic
1122508683 14:102248786-102248808 AAAAAAAAAAAACCAACCCCAGG + Intronic
1123415901 15:20095027-20095049 AAAAAAGAGAGATACACTCCAGG + Intergenic
1123525241 15:21102141-21102163 AAAAAAGAGAGATACACTCCAGG + Intergenic
1124433402 15:29627033-29627055 AAAAATTAAGCACCCACCCCAGG - Intergenic
1124953034 15:34340952-34340974 AAAAAAGAAAGACCCAGGCCAGG + Intergenic
1126347369 15:47710297-47710319 ACAAATGAGAAACCGACCCCTGG + Intronic
1127847220 15:62881356-62881378 GAAAAAGTGACACCAAGCCCTGG - Intergenic
1128929529 15:71691711-71691733 AAAAAAGAGAAACACTTCCCAGG - Intronic
1129239648 15:74243950-74243972 AAAAAAAAAACACTCAGCCCTGG + Intronic
1130303963 15:82700383-82700405 AAAAAAAAGCCACCCACCACTGG - Intronic
1130931999 15:88436287-88436309 AAAAAAGAGACACTCAGTTCTGG - Intergenic
1133469498 16:6060852-6060874 CAGAAGGAGACACCAACCCCAGG - Intronic
1133733468 16:8595877-8595899 AAAAAAAAAGCATCCACCCCAGG + Intergenic
1134641151 16:15830138-15830160 AAAAAAAAGACACACAGGCCTGG + Intronic
1135517810 16:23149686-23149708 CAAAGACAGAGACCCACCCCGGG - Intergenic
1136498337 16:30657592-30657614 AAAAAAGAGACAGCCATTTCTGG - Intergenic
1136864777 16:33738324-33738346 AAAAAAGAGACATCCACTCTGGG + Intergenic
1137630197 16:49937903-49937925 AAATTAGAGACACAGACCCCTGG - Intergenic
1138456104 16:57121638-57121660 AAGAAAGAGACACTCACCTCGGG - Intronic
1139329041 16:66173405-66173427 AAAGAAGAAACACCCAGGCCGGG + Intergenic
1139769143 16:69259168-69259190 AAAAAAGAAACACCAACTGCTGG - Intronic
1140767504 16:78174146-78174168 AATAAAGACACACCCACGACTGG + Intronic
1203126274 16_KI270728v1_random:1586460-1586482 AAAAAAGAGACATCCACTCTGGG + Intergenic
1142591605 17:1008624-1008646 AAAAACAAGACACCAGCCCCGGG + Intronic
1143754058 17:9053700-9053722 AAAAAAGAGACAGCCACCTTCGG + Intronic
1144107026 17:11995385-11995407 AAAAAAAAGAAACCCAGGCCAGG + Intronic
1145779677 17:27553940-27553962 ATAAAATAGACCCACACCCCTGG - Intronic
1146462284 17:33055658-33055680 AAAAATCAGACACCAAGCCCTGG - Intronic
1148382302 17:47209000-47209022 AAAAAAGCCTCACCCTCCCCTGG + Intronic
1149256835 17:54836675-54836697 AGAAAGGAGCCACCCACTCCAGG - Intergenic
1149899335 17:60459473-60459495 AAAAAAGGGACTACAACCCCAGG - Intronic
1151672679 17:75580316-75580338 AAAGAAGAGGCACCCAGGCCGGG + Intergenic
1152480464 17:80548362-80548384 AAAAAAAAAAAAACCACCCCAGG - Intronic
1152696841 17:81801955-81801977 AAATAAGGGTCACCCAGCCCAGG + Intergenic
1153647712 18:7210201-7210223 AAAAAAGAGACAAGCAAGCCAGG + Intergenic
1155830842 18:30513543-30513565 AGAGAGGAGCCACCCACCCCAGG - Intergenic
1157107277 18:44786294-44786316 AAAGAAGACACACACACCCCAGG + Intronic
1157832277 18:50867497-50867519 AAAAAAGAAAAAGCCACTCCAGG - Intergenic
1157991620 18:52503762-52503784 AGAAATGAGACACCCAACCTGGG - Intronic
1158210046 18:55038939-55038961 AGAAAAGAGACACACACCAATGG + Intergenic
1158445635 18:57518220-57518242 TAAGAAGAGATACCCACTCCAGG - Intergenic
1158593730 18:58798763-58798785 AAAAAAAAAAAAACCACCCCAGG + Intergenic
1159102577 18:63971852-63971874 AAACCATAGAAACCCACCCCAGG + Intronic
1159605090 18:70466696-70466718 AAAAAAAAAACACCCAGCTCAGG - Intergenic
1160280008 18:77480408-77480430 AGAACAGAGAAACCAACCCCCGG - Intergenic
1160713324 19:563547-563569 AAAAAAGAGGCAACCTCCCAGGG - Intergenic
1162052099 19:8040793-8040815 AAAAAAGCGAAACCCAGGCCAGG - Intronic
1163860704 19:19741238-19741260 AAAAAAAAAAAACCCATCCCTGG - Intergenic
1164665396 19:30029840-30029862 AAAAAAGGGACAATAACCCCTGG - Intergenic
1164701747 19:30289586-30289608 AATAAAGAGAGAAGCACCCCTGG - Intronic
1164789653 19:30965178-30965200 AAAAACAACACAACCACCCCAGG - Intergenic
1167375461 19:49108540-49108562 ACAAATGAGACACCTACCCTTGG - Intronic
1167517074 19:49929638-49929660 AAAAAAAACACACCCTCCCCTGG - Intronic
925294455 2:2768128-2768150 AAAGAAGAGACACACAGCCTGGG - Intergenic
927224697 2:20752302-20752324 GAAAATCAGACACCCAACCCAGG + Intronic
928360371 2:30657683-30657705 AAGAAAGACATACCCACCACTGG + Intergenic
928840504 2:35599300-35599322 AAAAAGGAGCTACCCACTCCAGG + Intergenic
929238585 2:39630101-39630123 AAATAAGAGACACAAACACCAGG - Intergenic
929387126 2:41422636-41422658 AAAAAAGAGACACAGACCAATGG - Intergenic
929968295 2:46551886-46551908 CAAAATGAGACAGCCACCACTGG - Intronic
930868779 2:56149134-56149156 AAAAATGAGAAATCCACTCCAGG - Intergenic
931444414 2:62314923-62314945 AAAAAAGAGTCACACCACCCAGG + Intergenic
931714324 2:65016993-65017015 ATGAAACAGAAACCCACCCCAGG - Intronic
932957918 2:76377069-76377091 AAACAAGAGACCCCTTCCCCAGG + Intergenic
933630226 2:84647432-84647454 AAAAAGGAGAAACCAACACCTGG + Intronic
935117713 2:100151587-100151609 AAAAAAGAAACACTCAGCCCAGG - Intergenic
936489370 2:112957201-112957223 GGAAAAAAGACAGCCACCCCTGG - Intergenic
936920894 2:117687384-117687406 AAAAAAAAAACAACCAACCCAGG - Intergenic
937459728 2:122075436-122075458 AACAAACAAACACCCAGCCCTGG + Intergenic
937891632 2:126943577-126943599 TAGAAATAGACTCCCACCCCAGG + Intergenic
938204464 2:129406625-129406647 CAAAAAGACAAACCCAACCCAGG - Intergenic
945330106 2:208529753-208529775 AGAAAAGAGGTACCCACTCCAGG - Intronic
945840445 2:214881376-214881398 AAACAAGAGACACCCAGCAAAGG + Intergenic
946476170 2:220008626-220008648 AACCAAGATACACCCACCCTGGG - Intergenic
946783550 2:223218759-223218781 AAGAAAGAGACTCCCACATCGGG + Intergenic
1168837262 20:885481-885503 AGAAAAGAGATACCCGGCCCTGG + Intronic
1169358035 20:4924335-4924357 CAGAAAGAGACACCCATTCCAGG - Intronic
1171897152 20:30818280-30818302 AAGAAAGACACAAGCACCCCTGG + Intergenic
1172462049 20:35126576-35126598 AAAAGGGAAAAACCCACCCCAGG - Intronic
1175276228 20:57772745-57772767 AAAAATGAGTCATCCACCCCAGG + Intergenic
1175422356 20:58842288-58842310 CAAAATGAGACACGCACACCAGG - Intronic
1177825456 21:26077787-26077809 AAAAAAAAGACAGACACTCCTGG + Intronic
1179585257 21:42370436-42370458 AAAAAAGCAACTGCCACCCCAGG + Intergenic
1180324709 22:11359839-11359861 AAGAAAGACACAAGCACCCCTGG - Intergenic
1181159036 22:20945786-20945808 ACAAAGGAGACAAACACCCCTGG - Intronic
1182473796 22:30564808-30564830 AAAAGAGACACACTCACCTCGGG + Exonic
1184574720 22:45353911-45353933 AAAAAAAAAACAACCACCACCGG + Intronic
950141221 3:10617411-10617433 AAGAAAGTGACAGCCATCCCCGG + Intronic
954425024 3:50438661-50438683 AACATAGAGACAGCCACCACAGG + Intronic
955600525 3:60640882-60640904 AAAAAAGAAACACACAGGCCAGG + Intronic
957085628 3:75674333-75674355 AAGAAAGACACAAGCACCCCTGG + Intergenic
957400778 3:79710281-79710303 TAAAAAAAGAAACCCACACCTGG + Intronic
960036099 3:113104584-113104606 GAAAAAGAGACACCCTCGCTTGG - Intergenic
960599085 3:119437543-119437565 AAAAAAGAGGGAACCACCACGGG + Intronic
960778339 3:121287832-121287854 AAAAAAGAAAGACCCACACATGG + Intronic
968193846 3:196690779-196690801 AAAAAAAAGCAACCCACCCCAGG + Intronic
969865673 4:10075675-10075697 AAAAAAGAGGTACCCGGCCCCGG - Intronic
971138596 4:23898822-23898844 AAAAAAAAAATACCCACCTCAGG - Intronic
971386176 4:26142289-26142311 AAAAAAGACACACATAGCCCAGG + Intergenic
971837997 4:31794122-31794144 AAAAAAAAGACGCCCCCTCCTGG - Intergenic
973041192 4:45472141-45472163 AAAGAGGAGCCATCCACCCCAGG + Intergenic
974235846 4:59180080-59180102 AGAAAGGAGCTACCCACCCCGGG + Intergenic
976147690 4:82058309-82058331 CAAAAAGACACCCCCACCCCTGG + Intergenic
979637898 4:122978212-122978234 AGAAAGGAGCCACCCACTCCAGG - Intronic
980306230 4:131064701-131064723 AGAGAAGAGTTACCCACCCCAGG - Intergenic
980671169 4:136008826-136008848 AGAGAAGAGCTACCCACCCCAGG + Intergenic
980843558 4:138296569-138296591 GAAAAAGAGACACACACTTCAGG + Intergenic
981244068 4:142513700-142513722 ATAAAAGAGACCCCCAGGCCAGG - Intronic
982024965 4:151243135-151243157 AAAAAAGAAAGACCTATCCCTGG + Intronic
982788871 4:159567287-159567309 AAAAAAATGACACCCACCTGGGG - Intergenic
984508868 4:180654620-180654642 AGCAAAGAGACACTCATCCCAGG + Intergenic
985444385 4:190013192-190013214 AAGAAAGACACAAGCACCCCTGG - Intergenic
985516964 5:351939-351961 ACAAAAGAGACCCAAACCCCTGG + Intronic
986344673 5:6823259-6823281 CAGAAAGCGACAGCCACCCCTGG - Intergenic
986716836 5:10531012-10531034 GAGAAAGAGAAACCCACCACAGG + Intergenic
987076189 5:14383974-14383996 AAACAAGAGTCTCCCATCCCCGG + Intronic
987467094 5:18284992-18285014 ATAAAAGACACACCCACAACTGG + Intergenic
989170824 5:38469215-38469237 AAAGAAGAGACATCCTCCCAGGG - Intergenic
989440591 5:41467905-41467927 AAAACAGAGACATCAACCCATGG - Intronic
991133330 5:63151942-63151964 AAAACAGAGACACCCTTACCAGG + Intergenic
992320379 5:75607839-75607861 AAAAAATGGAGAGCCACCCCAGG + Intergenic
994010889 5:94901082-94901104 AATAAAGACACACCCAACACTGG + Intronic
995439118 5:112170634-112170656 AGAAAAAAGACACCTACCACAGG - Intronic
996247061 5:121277633-121277655 AAATAAGAAAGACCCACCACAGG + Intergenic
996397536 5:123028226-123028248 AAAAAAGTGACTCACACTCCTGG - Intronic
996613459 5:125411945-125411967 AAAAAAAAAATACCAACCCCGGG - Intergenic
997256865 5:132435709-132435731 AAAAAAAAAAAACCCACCTCTGG - Intronic
997826881 5:137114351-137114373 AAAGAAGAGAGACACATCCCTGG - Intronic
999737635 5:154524543-154524565 AAACAAGAGACACCCAGCAAAGG + Intergenic
1002869564 6:1154845-1154867 AGAAAAGAGATACCCACAACTGG + Intergenic
1004803231 6:19174186-19174208 AAATAAGTGATCCCCACCCCTGG + Intergenic
1007022747 6:38538637-38538659 CCAAAAGAGACACCCAGCCTGGG + Intronic
1007152690 6:39710045-39710067 AAAAAAGTGATTCCCTCCCCAGG + Intronic
1007641364 6:43342513-43342535 ACAAAGGAGACACCATCCCCAGG - Intronic
1007811577 6:44490072-44490094 CAAAAAGAGACAGGCTCCCCTGG - Intergenic
1007915922 6:45561717-45561739 AAGAAAGAGAGAATCACCCCAGG + Intronic
1008302590 6:49859409-49859431 AAAAAAGAAACATCCACCTATGG + Intronic
1008421739 6:51308947-51308969 GAAAAATAGACAGCCACCCAAGG - Intergenic
1009921575 6:70068195-70068217 AAAAAAGGCAGACCCACACCAGG - Intronic
1012435863 6:99214835-99214857 AAAAAAGAGACAGAATCCCCTGG - Intergenic
1016074093 6:139775687-139775709 AAAAAAATGACACCTTCCCCTGG + Intergenic
1016377693 6:143440449-143440471 AAAAAGGAGACGCCCACAGCAGG + Intronic
1016865294 6:148759900-148759922 AGAAAAGAAACACTCTCCCCTGG - Intronic
1016942024 6:149490480-149490502 AAAAAAAAGACACCCATCATTGG - Intergenic
1017359766 6:153554049-153554071 GAAAAAGTCACACCCACCCTGGG - Intergenic
1018718419 6:166553522-166553544 AAAAAAAAGGCACCCACTCGTGG + Intronic
1019635573 7:2073873-2073895 AGCAGAGAGACACCCACTCCAGG + Intronic
1020087423 7:5318435-5318457 GAAAAAAAGACACACACACCAGG + Intronic
1020087425 7:5318437-5318459 AAAAAAGACACACACACCAGGGG + Intronic
1020988449 7:15166047-15166069 ACAAAACAGACAACGACCCCAGG + Intergenic
1022179921 7:27909404-27909426 AAAAAAAAAAAACCCACCACTGG + Intronic
1022456661 7:30564030-30564052 CAAAAAGAGAAAGTCACCCCAGG - Intergenic
1023134917 7:37041765-37041787 AGAAAAGCAACCCCCACCCCAGG + Intronic
1023576167 7:41629709-41629731 AAAAAAGAGGAAGCCACCACTGG + Intergenic
1025206885 7:56998731-56998753 AAAAAAGACACACACACCAGGGG - Intergenic
1025206887 7:56998733-56998755 GAAAAAAAGACACACACACCAGG - Intergenic
1025665053 7:63578163-63578185 GAAAAAAAGACACACACACCAGG + Intergenic
1025665055 7:63578165-63578187 AAAAAAGACACACACACCAGGGG + Intergenic
1026452929 7:70545194-70545216 AAAAGAGAGCCACCCAGCCAGGG + Intronic
1026660132 7:72293398-72293420 TAAAAAGAGACAGCCACTGCTGG + Intronic
1029116543 7:98240708-98240730 AAAAAAGAAAAACCCAGGCCGGG - Intronic
1029252172 7:99244750-99244772 GAAAGAGCCACACCCACCCCCGG + Intergenic
1029821348 7:103150271-103150293 AAAAAAGAAACCACCACCACAGG + Intergenic
1029841613 7:103370407-103370429 AAAACACACCCACCCACCCCAGG + Intronic
1032843818 7:135735996-135736018 AAGAAAGAGACAGCCAGGCCAGG - Intronic
1034864392 7:154628504-154628526 AAAAAAGTGACACCCTCAACTGG + Intronic
1035603783 8:915552-915574 AAAAAAAAGAAACCCATCGCTGG + Intergenic
1036165561 8:6429512-6429534 AAAAAAGGGAAACCCAAGCCTGG - Intronic
1036734607 8:11299975-11299997 AAAAAAGAAACATCCACAACTGG - Intronic
1037360465 8:18068697-18068719 AAAAAAGAGACACCCACCCCAGG + Intronic
1037360479 8:18068770-18068792 AAAAAAGAGACACCCACCCCAGG + Intronic
1037667487 8:20982757-20982779 GAAAAAGAGACTCCCACTTCTGG - Intergenic
1037777836 8:21847471-21847493 AGAGAAGAGTCACCCACCCCAGG - Intergenic
1037823521 8:22147337-22147359 AGAACAGAGACAGACACCCCTGG + Exonic
1038013145 8:23490692-23490714 AAAAAGGAAACACTCTCCCCTGG + Intergenic
1040752700 8:50729536-50729558 ACAAAAGAGACCCCCATCACTGG - Intronic
1042129132 8:65569614-65569636 AAAAAAATGACACCAACCCAGGG + Intergenic
1043155827 8:76778130-76778152 AAACAGGTGACACCCACCCATGG - Intronic
1043314908 8:78908394-78908416 AAAAAAGAAAGAACCACCACAGG - Intergenic
1044002724 8:86904505-86904527 AAAAAAGAGAAGCCCACCCAGGG + Intronic
1045188780 8:99863486-99863508 GAGAGAGAGAGACCCACCCCTGG + Intronic
1045413436 8:101943196-101943218 AAAAAAGAGACTCCCCATCCAGG + Intronic
1048018674 8:130519535-130519557 AAAAGAGGGGAACCCACCCCAGG - Intergenic
1048018820 8:130520037-130520059 AACAGAGGGGCACCCACCCCAGG - Intergenic
1048018908 8:130520346-130520368 AACAGAGGGGCACCCACCCCAGG - Intergenic
1048961458 8:139582935-139582957 TAAATAGAGACACACACCCAGGG + Intergenic
1049380385 8:142311148-142311170 AAAAAAAAAACAACCACCCTTGG - Intronic
1049514725 8:143047988-143048010 AAACAAGAGACACACAGCCAAGG - Intronic
1051067475 9:13122017-13122039 AAGAAAGAAACACTCCCCCCAGG + Intronic
1052699449 9:31920524-31920546 AAAAAAAAGTCCCCAACCCCTGG + Intergenic
1053586064 9:39460207-39460229 AGAAAAGAGAAATCCACACCTGG + Intergenic
1054352176 9:64027351-64027373 AAAAAAAAGACACACACACAGGG + Intergenic
1056155704 9:83834278-83834300 AAAAATTAGACACCTACCCAAGG - Intergenic
1056334950 9:85559183-85559205 GAAAGAGAAACACCTACCCCAGG + Intronic
1056556798 9:87696095-87696117 AAAAAAGAGAGAACCACCTGGGG - Intronic
1056943938 9:90977867-90977889 GAAACAGAGATTCCCACCCCAGG + Intergenic
1059552207 9:115240454-115240476 AAAAAGGATATATCCACCCCAGG - Intronic
1060668287 9:125446621-125446643 GACAAAGAGACACCCCCTCCAGG + Intronic
1061431120 9:130531936-130531958 AAAAAAAAGAAACCCAGCCCTGG - Intergenic
1062730899 9:138108039-138108061 AAAAAAGAGATAACCAGGCCAGG + Intronic
1203372360 Un_KI270442v1:320398-320420 AAGAAAGACACAAGCACCCCTGG - Intergenic
1203376020 Un_KI270442v1:378585-378607 AAGAAAGACACAAGCACCCCTGG - Intergenic
1185484137 X:469361-469383 TAAAAGGAGACCCCCTCCCCAGG - Intergenic
1190741499 X:53291827-53291849 AAACCAGAGGCCCCCACCCCAGG + Intronic
1191254787 X:58275029-58275051 ATGAAAGAGACACCCACGCCAGG + Intergenic
1192716987 X:73653411-73653433 AAAAAACAGACACATACACCAGG - Intronic
1193020962 X:76792548-76792570 AAAAAGGAGATTCCCATCCCCGG - Intergenic
1196078617 X:111606258-111606280 AAAAAAGATACCCCCACTCAAGG + Intergenic
1196174417 X:112625361-112625383 AAAAAAAAAAAACCCAGCCCTGG - Intergenic
1196550442 X:117017763-117017785 AACCAAGAGACACAAACCCCAGG + Intergenic
1197525928 X:127562773-127562795 AAAAAAGAGACACATACCAAAGG - Intergenic
1198702942 X:139416824-139416846 AAAAAAGACACACCCAAAACTGG - Intergenic
1198912441 X:141629556-141629578 CCAAAAGAGACAACCACGCCCGG - Intronic
1200063269 X:153492987-153493009 AAAAAGGAGAAACCCACTCAAGG - Intronic
1201427853 Y:13874137-13874159 CCAAAAGAGACAACCACACCCGG - Intergenic
1202587077 Y:26442415-26442437 AAATAAGGGACATCCACCCTGGG - Intergenic