ID: 1037360480

View in Genome Browser
Species Human (GRCh38)
Location 8:18068774-18068796
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 2, 1: 0, 2: 2, 3: 29, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037360475_1037360480 6 Left 1037360475 8:18068745-18068767 CCTGCAATGCACATGACAGCCCC 0: 2
1: 37
2: 249
3: 688
4: 1430
Right 1037360480 8:18068774-18068796 AAGAGACACCCACCCCAGGCCGG 0: 2
1: 0
2: 2
3: 29
4: 224
1037360474_1037360480 23 Left 1037360474 8:18068728-18068750 CCTGAGCTGCTAAACATCCTGCA 0: 1
1: 1
2: 5
3: 39
4: 170
Right 1037360480 8:18068774-18068796 AAGAGACACCCACCCCAGGCCGG 0: 2
1: 0
2: 2
3: 29
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900157651 1:1209784-1209806 AAGAAACACACAGCCGAGGCCGG - Intergenic
900399437 1:2467029-2467051 AAGAGCCACTCACCCCAGGAGGG - Intronic
902077845 1:13801870-13801892 AACAGACACCCAGCCCAGCCAGG - Intronic
902393350 1:16118979-16119001 AGGGGGCCCCCACCCCAGGCAGG + Intergenic
903224452 1:21886941-21886963 ACGAGACACGAACCACAGGCAGG + Intronic
904250834 1:29223090-29223112 ATGAGGCACCCAACCCAGCCTGG + Intronic
904620331 1:31771502-31771524 CAGAGACACGCACCACAGGCTGG - Intergenic
905394178 1:37656753-37656775 CAGAGACAGCCACCCTAGGGAGG - Intergenic
905495503 1:38382311-38382333 AAGAGTCACCCAGACCAGCCTGG + Intergenic
907559333 1:55374431-55374453 CAGAGACAGCCTCCCCAGGTAGG - Intergenic
912755967 1:112325167-112325189 AGGATACACCCACCCAAGGACGG - Intergenic
913125947 1:115790427-115790449 GAGAGACACACAGCCCAGGATGG + Intergenic
914921903 1:151852964-151852986 AGGAGCCACCCTGCCCAGGCAGG - Intronic
915937453 1:160097860-160097882 AAGAGGGACCCAACCCAGGGTGG + Intronic
917135431 1:171784374-171784396 CAGAGACACACTCCCCAGCCTGG - Exonic
917264757 1:173209248-173209270 GAGATACACACACACCAGGCTGG + Intergenic
917674111 1:177302912-177302934 ATGAGACAGCCAGCACAGGCTGG - Intergenic
918187277 1:182139365-182139387 TAGGGACACGCATCCCAGGCAGG + Intergenic
920147304 1:203872919-203872941 AAAAGACACCACCCCCAAGCAGG - Intergenic
920195515 1:204223652-204223674 AAGCGAGGCCCTCCCCAGGCAGG + Intronic
922541647 1:226424779-226424801 ACAAGACAACCAACCCAGGCTGG - Intergenic
922788773 1:228298058-228298080 AGGAGATACCCATCCCAGGCAGG - Intronic
924768682 1:247059143-247059165 AAAAAATACACACCCCAGGCTGG + Intronic
1063176058 10:3552048-3552070 AGGAGAAACCCACCGCAAGCTGG + Intergenic
1063970582 10:11378901-11378923 AAGAGGCACCCACAGCAGGGGGG + Intergenic
1064339534 10:14473936-14473958 AAGCGACATCTACCCCAGGGGGG - Intergenic
1067067537 10:43112298-43112320 CAGGGAGAGCCACCCCAGGCTGG - Intronic
1067765100 10:49079704-49079726 CAGAGACACCCAGCCCAGCCTGG + Intronic
1068555163 10:58450351-58450373 ATGAGCCACCCACACCTGGCCGG - Intergenic
1069860191 10:71465991-71466013 AAGAGCCGCCCAGCACAGGCCGG - Intronic
1071858650 10:89650452-89650474 GAGAGGCACCCAACCCAGCCTGG - Intergenic
1072725240 10:97808695-97808717 ATGAGCCACCCACGCCCGGCTGG + Intergenic
1073747196 10:106482536-106482558 AGGAGGCACCCACCAGAGGCAGG - Intergenic
1075412699 10:122240654-122240676 TAGAGACCCCCACCCCGGTCAGG - Intronic
1075894378 10:125982311-125982333 CACAGACACACACCTCAGGCTGG - Intronic
1076282317 10:129258716-129258738 AAGAGGCACACACCCAAGTCAGG + Intergenic
1076570320 10:131428391-131428413 AAGAAACAACCATTCCAGGCTGG - Intergenic
1077606011 11:3612966-3612988 AAGAAACCCCAAACCCAGGCTGG - Intergenic
1077787557 11:5401104-5401126 AAAACACACCCAATCCAGGCAGG + Intronic
1079139409 11:17798063-17798085 CAGATACACGCTCCCCAGGCTGG + Intronic
1079535798 11:21513915-21513937 ATGAGACACCCACCCCTGCCTGG + Intronic
1081767646 11:45622563-45622585 AAGTCACACCCATCCCAGGGTGG + Intergenic
1082919187 11:58473810-58473832 AAGAGACAGGCACACCTGGCGGG - Intergenic
1085030786 11:73269767-73269789 GAGAGCCACCAACCCCAGTCAGG - Intronic
1089869189 11:121657122-121657144 AAGAGACACCCTTTCCTGGCTGG - Intergenic
1090902937 11:131048321-131048343 GAGAGCCACCTACCCCATGCAGG + Intergenic
1094642263 12:32287831-32287853 AAGAACCACCCAGCCGAGGCCGG - Intronic
1096683813 12:53274670-53274692 GAGCCACACCCACCCAAGGCAGG - Intronic
1099690493 12:85945766-85945788 AAGAGACACCTACCATAGTCAGG + Intergenic
1102603756 12:114053121-114053143 AAGAGACATCCTCCTCAGGAAGG + Intergenic
1102822336 12:115918376-115918398 AAAACACACCCACCCAAGGCAGG + Intergenic
1103487663 12:121294227-121294249 AAGAATCACCCTCCCCTGGCTGG - Intronic
1104795093 12:131511722-131511744 GTGAGACAGTCACCCCAGGCTGG + Intergenic
1109517328 13:63460897-63460919 AAGAGACTACCACCACAGGGAGG - Intergenic
1118116362 14:62781523-62781545 AAGAGACGGCCACGCCCGGCGGG + Intronic
1119552064 14:75522241-75522263 AAGAGAAAAACAGCCCAGGCAGG - Intergenic
1120993191 14:90396768-90396790 AGGAGACGCCCACCCTGGGCGGG - Intronic
1121825773 14:97008408-97008430 TGGATTCACCCACCCCAGGCAGG + Intergenic
1121833426 14:97071458-97071480 AAGAGACACCCAGCCCTGTGGGG - Intergenic
1122803607 14:104245383-104245405 AGGTGACACCCACCCCAGGGTGG + Intergenic
1123044712 14:105505920-105505942 AAGAGACACCAACGCAAGGAAGG + Intergenic
1123701376 15:22917079-22917101 TCGACACACACACCCCAGGCAGG + Intronic
1127975048 15:63990909-63990931 CAGTGACACCATCCCCAGGCAGG - Intronic
1128788876 15:70418094-70418116 AGGAGACACACACCCCATTCTGG - Intergenic
1128966272 15:72061466-72061488 AAGAGAGACCCAAGCCTGGCAGG + Intronic
1129350359 15:74952429-74952451 AAGAGAAATCCACTGCAGGCCGG + Intergenic
1129381045 15:75166675-75166697 AAGATAACCCCACACCAGGCCGG - Intergenic
1130303962 15:82700379-82700401 AAAAGCCACCCACCACTGGCAGG - Intronic
1131863971 15:96686955-96686977 AAGAGACACCAACTTCAGGACGG + Intergenic
1132109957 15:99095823-99095845 AAGAGACCCTCACCCCCTGCAGG + Intergenic
1132175831 15:99713268-99713290 AACAGACACCCATGCCAGGTTGG - Exonic
1132781942 16:1631948-1631970 AAGAGGCAAGCACCCCAGACAGG - Intronic
1132968073 16:2670752-2670774 AAGACAGAACCACCCCAGGGAGG + Intergenic
1134054357 16:11160189-11160211 AAGCGGCACCAACTCCAGGCAGG + Intronic
1134157001 16:11851931-11851953 AGGCGACGCCAACCCCAGGCTGG + Intergenic
1136010288 16:27359194-27359216 CAGAGAAGCCCACCCCAGGCTGG - Intronic
1136668982 16:31839291-31839313 AAGAGACACCTCCACCAGGTGGG + Intergenic
1140604571 16:76519028-76519050 AAGAGACACCCACCAGAATCTGG - Intronic
1141424495 16:83936199-83936221 AAAAGACCCCGAACCCAGGCAGG + Intronic
1142155016 16:88528982-88529004 ATGAGTCACTCACCCCCGGCCGG + Intronic
1143774131 17:9186573-9186595 CAGCCACTCCCACCCCAGGCTGG - Intronic
1143784628 17:9247316-9247338 ATGAGACCCCCACCCCAACCAGG - Intergenic
1148144761 17:45356119-45356141 ACCAGACACTCATCCCAGGCTGG - Intergenic
1148547751 17:48530327-48530349 AAGAGAAACCCACCCAAGACAGG - Exonic
1148813011 17:50306751-50306773 AACAGAAACCCAACTCAGGCCGG + Intergenic
1148894704 17:50833035-50833057 AAGCGACCCCCAGCCCATGCTGG - Intergenic
1150329924 17:64286469-64286491 GAGAAACACATACCCCAGGCCGG - Intergenic
1151598056 17:75089804-75089826 ACCTGACTCCCACCCCAGGCTGG - Intronic
1151675275 17:75594412-75594434 AATGGACACACTCCCCAGGCAGG - Intergenic
1152166857 17:78714650-78714672 AAGAGAACCCTACCCCAAGCAGG + Intronic
1152536922 17:80956150-80956172 AAGGGACAGCCCTCCCAGGCAGG + Intronic
1152941451 17:83174813-83174835 CAGAGACACCCCCGCCAGGTAGG - Intergenic
1153906166 18:9663320-9663342 AAGAGCCACCCAGCCCAGCCCGG - Intergenic
1153996722 18:10448661-10448683 AACAGACACAAACCCAAGGCTGG - Intergenic
1154285681 18:13054108-13054130 ATGAGCCACCAAGCCCAGGCTGG + Intronic
1154409585 18:14130685-14130707 AAGAAAAACCCACCCCAGGGAGG - Intronic
1154416253 18:14177545-14177567 AGGAGGCACCTACCACAGGCTGG + Intergenic
1155142213 18:23053825-23053847 CAGAGACACCAGCCCCAGCCCGG - Intergenic
1156499964 18:37551323-37551345 AAGAGAAACTCAGCCCAGGGGGG - Intronic
1156514108 18:37665526-37665548 GAGAGACTCCCAGCCCAGGTGGG + Intergenic
1159058086 18:63486427-63486449 AAGAGACACCATCATCAGGCAGG - Intronic
1159165781 18:64697556-64697578 AAGAGACACAAATACCAGGCTGG - Intergenic
1160147718 18:76378611-76378633 GAGGGCCACCAACCCCAGGCAGG + Intronic
1160894522 19:1396339-1396361 AAGAGGCACCCAGCCCAGCCGGG + Intergenic
1161155857 19:2731675-2731697 AGGAAAAACCCAGCCCAGGCGGG + Intronic
1162215499 19:9130393-9130415 TACAGACACACAACCCAGGCTGG - Intergenic
1163612886 19:18310175-18310197 GAGAGAGCCCCATCCCAGGCTGG - Intronic
1163760363 19:19133085-19133107 AGGAGCCACCCTCCCAAGGCTGG + Intronic
1164611465 19:29635262-29635284 AAGACACTCACACCCCAGGCAGG - Intergenic
1164698492 19:30264660-30264682 CACACACACCCACCCCAGTCTGG + Intronic
1164722161 19:30440255-30440277 AAGAGAAAGCCACCTCTGGCCGG - Intronic
1165484713 19:36088758-36088780 AAGGGACACCCTCTCCAGTCTGG - Intronic
1165933125 19:39373079-39373101 CAGTGACACCCAGCCCAGGAAGG - Intronic
1166344272 19:42155689-42155711 ACCTCACACCCACCCCAGGCCGG + Intronic
1167558798 19:50212781-50212803 AGAAGACACCAACCCCATGCAGG - Intronic
1167565714 19:50255309-50255331 CAGAGACACCCACCCCCTGGCGG - Exonic
1167690517 19:50981855-50981877 AAGAGGCTCCCACCCATGGCAGG - Exonic
1168186461 19:54703332-54703354 CAGAGACACCCCCTCCAGCCAGG + Intergenic
1168561724 19:57390105-57390127 ACGGGACACCCACCTCAGTCAGG - Exonic
926341661 2:11909248-11909270 GGGAGAGACACACCCCAGGCAGG - Intergenic
927236904 2:20882945-20882967 AATACACACACACACCAGGCTGG - Intergenic
927887994 2:26730318-26730340 AAGAAACACCCTTCCCAGGTGGG + Exonic
931437594 2:62262402-62262424 AATAAACACGCACCCCAGCCTGG - Intergenic
932124335 2:69129946-69129968 AAGAGACACCAACCCGAACCAGG + Intronic
932405905 2:71512565-71512587 GAGAGCCAGCCACCCCGGGCTGG - Intronic
932741353 2:74293312-74293334 CAAAGCCACCCACCCCAGGAAGG - Intronic
933190705 2:79330524-79330546 AAGAAAAAGCCACCCCTGGCTGG + Intronic
934034351 2:88076707-88076729 TTAAGACACCTACCCCAGGCTGG + Intronic
936789384 2:116133074-116133096 ATGAGCCACCCGCGCCAGGCCGG + Intergenic
937028854 2:118721577-118721599 AGGAGTCACCCTGCCCAGGCTGG + Intergenic
937948419 2:127363936-127363958 AAGAGCCACCAAGCCCAGCCAGG + Intronic
938634432 2:133207821-133207843 AAGAGACAAACATCCCATGCAGG + Intronic
940096103 2:149977979-149978001 GAAAGGCACCCGCCCCAGGCAGG + Intergenic
944480517 2:200152935-200152957 AAGAGTAACCCACCCCAGATAGG - Intergenic
944789622 2:203111142-203111164 GAGAGAGTCTCACCCCAGGCTGG - Intronic
944835462 2:203574931-203574953 AGGCAACACCAACCCCAGGCTGG + Intergenic
948583280 2:239002727-239002749 GAGAGACCCCCACCCCAGAGAGG - Intergenic
948630489 2:239299481-239299503 AAGAGACATGCACACGAGGCAGG + Intronic
1169415320 20:5411308-5411330 AAGAGACACACACCCTGGGAAGG - Intergenic
1169558174 20:6770317-6770339 AACAGAGACCCACCCCCAGCAGG + Exonic
1172686259 20:36757367-36757389 AAAAAACACCCAGCCCAGCCTGG + Intronic
1173165664 20:40685397-40685419 AGGAGACTTGCACCCCAGGCAGG + Intergenic
1174269693 20:49358779-49358801 AAGAGACACACATCCCAGTGGGG - Intergenic
1175292076 20:57882590-57882612 AAGCGCCACCCTCCCAAGGCTGG - Intergenic
1176199949 20:63855662-63855684 GGGAGCCACCCACCCCAGGAAGG + Intergenic
1176857092 21:13981752-13981774 AGGAGGCACCTACCACAGGCTGG - Intergenic
1176863642 21:14029170-14029192 AAGAAAAACCCACCCCAGGGAGG + Intergenic
1176867510 21:14062475-14062497 AGGAGGCACCTACCACAGGCTGG + Intergenic
1177560386 21:22743616-22743638 GAGAGACACACACACCAGACAGG + Intergenic
1179180584 21:39041610-39041632 ATGGGACACCCACCCCGGGCAGG - Intergenic
1179218830 21:39388934-39388956 AAGAAGCACGCTCCCCAGGCTGG - Intronic
1180052956 21:45341304-45341326 CGGAGGCATCCACCCCAGGCAGG - Intergenic
1180065423 21:45409861-45409883 AGGAGACAGCCAGCCCAGGCAGG + Intronic
1181745081 22:24950565-24950587 AAGAGATGCCCAGCCCAGACCGG - Intergenic
1182442695 22:30373472-30373494 CACAGACACACACCCCAGGGGGG + Intronic
1182551660 22:31104064-31104086 AAGAGAGCCCCATCCCAGTCAGG - Intronic
1183848074 22:40559371-40559393 AAGTGATACCCATCCCAGGGAGG + Intronic
1185137060 22:49079152-49079174 ATGAGGCACCCACACCAGGCAGG - Intergenic
1185331495 22:50254035-50254057 CGGGCACACCCACCCCAGGCTGG + Intronic
950306679 3:11920350-11920372 AATAGACACCCATTACAGGCTGG - Intergenic
953352568 3:42226989-42227011 AAGAGAAAGCCACTCCAGGGAGG + Intergenic
953703512 3:45214321-45214343 AAGAGACACCCCCTCCAGATAGG - Intergenic
954410779 3:50370005-50370027 CACAGACAGCCACCCCAGGGCGG + Intronic
955350371 3:58189117-58189139 GAAAGGCACCCAGCCCAGGCAGG - Intergenic
956996574 3:74832577-74832599 GAGAGACATCCACCCCAGTGAGG - Intergenic
958142850 3:89585804-89585826 TACAGAAACCCAACCCAGGCAGG - Intergenic
958480592 3:94641544-94641566 AATAGACACCAAAACCAGGCAGG - Intergenic
959653644 3:108776357-108776379 CAGAGACACCCAACCCAGTGGGG + Intergenic
961375433 3:126462391-126462413 AACCGACACACACCCCAGGAAGG + Intronic
961652346 3:128422799-128422821 CAGGGACAGCCAGCCCAGGCTGG + Intergenic
965475001 3:169146464-169146486 CAGAGAAACCCACCGAAGGCCGG + Intronic
968089877 3:195893203-195893225 AGGAGACACCCAGCCAAGGCTGG - Intronic
969080580 4:4614853-4614875 AAGAGAATTCCAACCCAGGCAGG + Intergenic
972734001 4:41822426-41822448 CAGAGACACAGACACCAGGCGGG - Intergenic
974405921 4:61469189-61469211 AAGAGCAATCCACACCAGGCAGG - Intronic
976280981 4:83326709-83326731 CAGAGAGAACCACTCCAGGCTGG + Intronic
978370932 4:108029099-108029121 AAGCAGCACCCACCCCAGGCAGG - Intronic
984508869 4:180654624-180654646 AAGAGACACTCATCCCAGGCAGG + Intergenic
984761312 4:183365178-183365200 AAGATACACCCATCCTGGGCAGG + Intergenic
985004682 4:185522246-185522268 ACGTTACCCCCACCCCAGGCTGG - Intronic
985746908 5:1652958-1652980 GAGAGACACCCGGCCCAAGCTGG - Intergenic
986344672 5:6823255-6823277 AAGCGACAGCCACCCCTGGCTGG - Intergenic
992641050 5:78768624-78768646 ATGAGCCACCCGCCCCAGCCGGG + Intronic
992851030 5:80807801-80807823 AACAGATACCCACCTCAGACCGG + Intronic
997744207 5:136284695-136284717 AAGAGGCACCCAGCCCAAGAAGG + Intronic
998446162 5:142200044-142200066 AATAGAAACCCACTCTAGGCCGG - Intergenic
999753468 5:154647333-154647355 AAGAGAAGTCAACCCCAGGCGGG - Intergenic
999975551 5:156908638-156908660 ATGAGCCACCCACACCTGGCTGG - Intergenic
1001319551 5:170668989-170669011 CAGGGACACCCAGCCCAGCCTGG - Intronic
1001622800 5:173102696-173102718 AAGAGACCCCCATGCCACGCTGG - Intronic
1002131117 5:177082215-177082237 AGGAGACACCAGGCCCAGGCAGG - Intergenic
1002494836 5:179604683-179604705 AAGAAAGACCCAGGCCAGGCTGG + Intronic
1002628800 5:180554049-180554071 TAGACACACCTACCCAAGGCTGG - Intronic
1003234021 6:4280561-4280583 AAGCTACACCCTCCCCAGCCTGG + Intergenic
1004623777 6:17355374-17355396 ATGAGACACACACTCCAGGAGGG + Intergenic
1005892829 6:30154110-30154132 AAGAGACACCCTCACCTGCCGGG + Exonic
1007719152 6:43875205-43875227 AAGAGGCACCTCCCCCAGGCTGG - Intergenic
1007811576 6:44490068-44490090 AAGAGACAGGCTCCCCTGGCAGG - Intergenic
1007919979 6:45598262-45598284 AAGATACACCCCCTTCAGGCAGG - Intronic
1008049845 6:46889601-46889623 AACACACACCTACCTCAGGCAGG - Intronic
1013827365 6:114230614-114230636 GACAGAGTCCCACCCCAGGCTGG + Intronic
1015137654 6:129891666-129891688 AGGACACACCCAGCCCACGCAGG - Intergenic
1017231621 6:152079165-152079187 AAGAGACCGCCACCTCAAGCAGG + Intronic
1021969454 7:25951656-25951678 AGGAGACACCGGGCCCAGGCAGG - Intergenic
1028879856 7:95867911-95867933 AAGAAAGACCCACTTCAGGCAGG + Intronic
1029121219 7:98269660-98269682 CAGAGACCCCCACCTCAGGCTGG - Intronic
1029609595 7:101619591-101619613 AAGAGACGTCCACCAGAGGCCGG + Intronic
1032819694 7:135513219-135513241 AAAAAACACTCACCACAGGCTGG + Intergenic
1035337944 7:158142152-158142174 AACAGTCACCCACTCCACGCAGG + Intronic
1035422514 7:158741461-158741483 AAGCGCCCCCCACCCCACGCTGG - Intronic
1036683275 8:10891675-10891697 TAGGGACACCTGCCCCAGGCTGG - Intergenic
1037017829 8:13930624-13930646 AAGAAACATGCACCCCAGGGGGG - Intergenic
1037360466 8:18068701-18068723 AAGAGACACCCACCCCAGGCCGG + Intronic
1037360480 8:18068774-18068796 AAGAGACACCCACCCCAGGCCGG + Intronic
1037360493 8:18068827-18068849 AAGAAATATCCAACCCAGGCCGG + Intronic
1037855349 8:22367452-22367474 AGGAGCCCCGCACCCCAGGCTGG + Intronic
1037986640 8:23294533-23294555 AGGACACTCCCACCCCAGGCTGG - Intronic
1040318313 8:46276504-46276526 GAGACACAGGCACCCCAGGCTGG + Intergenic
1040332926 8:46401472-46401494 AAAACACACGCACCCTAGGCTGG + Intergenic
1042515543 8:69655078-69655100 AATAGACACTTACCCCAGGCTGG - Intronic
1043706540 8:83357948-83357970 AGCAGATACTCACCCCAGGCAGG + Intergenic
1043877023 8:85497032-85497054 AAGGAACACCCACCCCAGAATGG + Intergenic
1043920630 8:85979455-85979477 AAGAGCCACCCTCACCAGCCTGG - Intergenic
1047596412 8:126382059-126382081 AAGAGACTCCCAGACCAGGCAGG + Intergenic
1049343107 8:142124294-142124316 AAGAGACCCCCAGGCCAGGTGGG - Intergenic
1049382498 8:142324452-142324474 AGGTGACACACCCCCCAGGCAGG - Intronic
1049618870 8:143588923-143588945 CAGGGACAGCCATCCCAGGCTGG - Intronic
1050240299 9:3627122-3627144 AAGGAACCCCCACCCCAGCCAGG - Intergenic
1056712557 9:89002451-89002473 AAGAGACATCCACACTGGGCAGG - Exonic
1058559017 9:106203885-106203907 AAAAGACACCAGCCCCAGTCAGG - Intergenic
1059767542 9:117397895-117397917 CAGAGACACCCACCCCCGACAGG + Intronic
1061009489 9:127946572-127946594 AAGAGGCCCCTCCCCCAGGCAGG - Intronic
1061850741 9:133413649-133413671 AAGAGACAGATTCCCCAGGCAGG - Intronic
1061875852 9:133543628-133543650 AGGAGACACTCACCCCAGCAGGG + Intronic
1062014714 9:134285234-134285256 AGGACACGCCCACCCCAGGCTGG - Intergenic
1062026239 9:134342039-134342061 CAGCAACACCCACCACAGGCAGG - Intronic
1062336114 9:136069200-136069222 AAAAGAAACTCACCTCAGGCTGG - Intronic
1062464665 9:136675726-136675748 AAGTGACATCAGCCCCAGGCTGG + Intronic
1185575093 X:1165004-1165026 AAGGGACTTCCACCCCGGGCGGG + Intergenic
1189164504 X:38847191-38847213 AAGAGACAGGCAACACAGGCAGG + Intergenic
1191254025 X:58272117-58272139 GACAGACACCCACCCCGGGTGGG + Intergenic
1191254118 X:58272506-58272528 GAGAGACATGCACCCCAGGTGGG + Intergenic
1191254789 X:58275033-58275055 AAGAGACACCCACGCCAGGTGGG + Intergenic
1191255626 X:58278374-58278396 GAGAGACACGCACCCCGGGAGGG + Intergenic
1191256126 X:58280370-58280392 AAGAGACACACACCCTGGGTGGG + Intergenic
1191256860 X:58283276-58283298 GAGAGACACCCACCCTGGGTGGG + Intergenic
1191257370 X:58285461-58285483 GAGAGACACGCACCCCAAGTGGG + Intergenic
1192137059 X:68612772-68612794 ATGAGCCACCGCCCCCAGGCAGG + Intergenic
1192169088 X:68843359-68843381 GAGAGACCCCCAGCCCAGGCCGG - Intergenic
1192876818 X:75238300-75238322 AATAGACACCCACAGCAAGCAGG + Intergenic
1193379766 X:80805637-80805659 AAAAAATACCTACCCCAGGCCGG + Intronic
1195084539 X:101401869-101401891 AAGAGAGAACCATTCCAGGCTGG + Intronic
1197714536 X:129696959-129696981 AATGCAGACCCACCCCAGGCTGG - Intergenic
1198386332 X:136132713-136132735 CAGAGACCCCCACCTGAGGCAGG - Intergenic
1198912437 X:141629552-141629574 AAGAGACAACCACGCCCGGGGGG - Intronic
1199367756 X:147007064-147007086 CAGAAAAACCCAACCCAGGCAGG + Intergenic
1201427851 Y:13874133-13874155 AAGAGACAACCACACCCGGGAGG - Intergenic