ID: 1037360484

View in Genome Browser
Species Human (GRCh38)
Location 8:18068783-18068805
Sequence CCACCCCAGGCCGGGCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 373}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037360478_1037360484 -6 Left 1037360478 8:18068766-18068788 CCACAAAAAAGAGACACCCACCC 0: 2
1: 0
2: 0
3: 26
4: 237
Right 1037360484 8:18068783-18068805 CCACCCCAGGCCGGGCATCCTGG 0: 1
1: 0
2: 1
3: 31
4: 373
1037360476_1037360484 -4 Left 1037360476 8:18068764-18068786 CCCCACAAAAAAGAGACACCCAC 0: 2
1: 0
2: 1
3: 24
4: 295
Right 1037360484 8:18068783-18068805 CCACCCCAGGCCGGGCATCCTGG 0: 1
1: 0
2: 1
3: 31
4: 373
1037360477_1037360484 -5 Left 1037360477 8:18068765-18068787 CCCACAAAAAAGAGACACCCACC 0: 2
1: 0
2: 1
3: 10
4: 237
Right 1037360484 8:18068783-18068805 CCACCCCAGGCCGGGCATCCTGG 0: 1
1: 0
2: 1
3: 31
4: 373
1037360475_1037360484 15 Left 1037360475 8:18068745-18068767 CCTGCAATGCACATGACAGCCCC 0: 2
1: 37
2: 249
3: 688
4: 1430
Right 1037360484 8:18068783-18068805 CCACCCCAGGCCGGGCATCCTGG 0: 1
1: 0
2: 1
3: 31
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037360484 Original CRISPR CCACCCCAGGCCGGGCATCC TGG Intronic
900168463 1:1254489-1254511 CCTCCGCAGGCCGGGCCTCCTGG - Intronic
900336164 1:2164919-2164941 TCACCCCAGGCCGTGTCTCCTGG + Intronic
900475740 1:2875610-2875632 GCACCCCAGGCCAGGCCACCAGG - Intergenic
900993896 1:6110060-6110082 CCACCCCAGGCCAAGGCTCCCGG + Intronic
901007756 1:6180017-6180039 CCTCCCCGCGCCGGGCATGCGGG - Exonic
901061392 1:6473507-6473529 CCACCCCAGGGCGGGTTTCCAGG + Intronic
901086649 1:6614970-6614992 CCTCCCCAGGCCTGGGACCCCGG + Intronic
901247289 1:7741922-7741944 CAACCCGAGGCCGGGCATGGTGG - Intronic
901654407 1:10761179-10761201 ACACCCAAGGCTGGGCACCCAGG + Intronic
901662287 1:10806078-10806100 GAACCCCAGGCCGGGCATGGTGG + Intergenic
902165720 1:14569820-14569842 CCACGCCTGGTGGGGCATCCTGG - Intergenic
903354749 1:22739808-22739830 CCAGGCCAGGCCGGGCATGTGGG - Intronic
903441810 1:23393933-23393955 CCGCCGCAGGCCGGGGTTCCTGG + Exonic
903501091 1:23800552-23800574 CCGCCCCAGCCCGGGCAGCGGGG + Intronic
904005487 1:27361099-27361121 CCACTCCCCCCCGGGCATCCTGG + Intronic
904468016 1:30719325-30719347 CCAGCCCCGGCCGGGCCTCCCGG - Intronic
905676360 1:39828170-39828192 CCACCTCAGGCTGGGCATGGTGG + Intergenic
906059097 1:42936649-42936671 CCAGGCCAGGCCAGGCCTCCCGG + Intronic
906489617 1:46258163-46258185 CAACACCAGGCCGGGCATGGTGG - Intronic
907588891 1:55646868-55646890 GCACCCCAGGAGGGGCAGCCTGG + Intergenic
908272956 1:62437668-62437690 CCTCCCCCGACCGGGCAGCCTGG + Intronic
909135454 1:71793394-71793416 CCATCCCAGGCCGGGCGTGGTGG - Intronic
909666022 1:78134481-78134503 CCACCCCATGCCAGGCTGCCTGG + Intronic
909693835 1:78441531-78441553 CCACTCCAGTCCGGGCATGGTGG - Intronic
915096525 1:153466503-153466525 CAGCCCCAGGCTGGGCCTCCAGG + Intergenic
915171726 1:153982790-153982812 CCACCCCAGCCGAGGCATTCTGG + Exonic
915238616 1:154503053-154503075 CCAACCCTCGCCTGGCATCCCGG - Intronic
915259611 1:154667338-154667360 CCACCACAGGCCTGGCATGGTGG + Intergenic
915279233 1:154810861-154810883 CTCCCCCAGGCAGGGCAACCTGG + Intronic
915469910 1:156119688-156119710 CCACCCCAGGCAAGGCAGCTGGG + Intronic
915488684 1:156239654-156239676 CCCGCCCAGGCCAGGCATGCTGG - Exonic
917159462 1:172041312-172041334 CCACCCCAGGCAGGGAATCTGGG - Intronic
919464621 1:197913593-197913615 CCAGCGCAGCCCGGGCATCCAGG + Intronic
921131304 1:212222171-212222193 CCATCCCAGGCCAGGCATGGTGG + Intergenic
922470769 1:225875774-225875796 CCACCCCTGGCCGGGCACCATGG + Intronic
922513189 1:226186588-226186610 CCGCCCCAGGCCGCTCCTCCGGG + Exonic
922720070 1:227895861-227895883 GCACCCCAGGCCTGGACTCCTGG + Intergenic
924764465 1:247019554-247019576 AAACCCCAGGCCGGGCACCATGG + Intergenic
1064985385 10:21204714-21204736 CCACCCCAGGCAGGGCAGGCTGG - Intergenic
1069856498 10:71443835-71443857 CCACCACAGGCGGGGCAGACAGG - Intronic
1070327762 10:75399522-75399544 CCCCACCAAGCCGGGCAGCCTGG - Exonic
1070401213 10:76055265-76055287 CCACCCCATGCCTGGTGTCCTGG - Intronic
1070610181 10:77927123-77927145 CCTCCCCAGGCCGTCCCTCCGGG + Intergenic
1070807226 10:79277705-79277727 CCAGCCCAGGCCAGCCACCCTGG + Intronic
1071495386 10:86164317-86164339 CCACCCCAGCGCTGGCATCCTGG - Intronic
1071507509 10:86241483-86241505 CCACCTCAGGCAGGGCCTCCAGG + Intronic
1071533941 10:86411965-86411987 CCAGGCCTGGCCGGGCATCGTGG + Intergenic
1071694056 10:87853405-87853427 CCACACCAGGCCAGGCATGGTGG - Intergenic
1073316524 10:102585022-102585044 CCACCCCAGGCACAGCAGCCTGG - Intronic
1074185389 10:111096446-111096468 CCACCTCAGGCCACGAATCCAGG - Intergenic
1075199372 10:120389342-120389364 TCACCCAAGGCCGGGCATGGTGG - Intergenic
1075316639 10:121458605-121458627 CCACCCCAGGCTTAGGATCCTGG - Intergenic
1075568576 10:123521880-123521902 CCAGCTCAGGCCTGGCAACCTGG - Intergenic
1075663264 10:124213006-124213028 CCATCCCAGGCCAGGCACCGTGG + Intergenic
1076806069 10:132859444-132859466 CCACCCCAGGCACTGTATCCAGG + Intronic
1077006340 11:359301-359323 CCACCCCAGTCCTGCCATGCTGG - Intergenic
1078857616 11:15219529-15219551 CCACCCAAGGCCTGGCTGCCAGG - Intronic
1079031864 11:16992077-16992099 CCCCCCCAGCCTGGGCATGCAGG + Intronic
1079069825 11:17334596-17334618 CTACCCTAGGCCGGGCATGGTGG + Intronic
1080379592 11:31754581-31754603 TCTCCCCAGGCTGGGCATGCTGG + Intronic
1080642925 11:34168213-34168235 CCAGCACAGGCCGTGCAGCCAGG + Intronic
1081623745 11:44634633-44634655 GCACCCCAGACCAGGCCTCCTGG - Intergenic
1082773135 11:57224293-57224315 CCACCCCCTGCCTGGCTTCCTGG + Intergenic
1083275684 11:61595707-61595729 CCACCCCACTCCTGGCATCAGGG - Intergenic
1083621918 11:64053492-64053514 CCAACCCAGGCCTGGGTTCCTGG - Intronic
1083955071 11:65978479-65978501 GCACCCCAGGCCTGGCATTGGGG + Intronic
1084090919 11:66878972-66878994 CCACCCTAAGCAGGTCATCCTGG + Intronic
1084604716 11:70165731-70165753 CCACCCCAGGCCAGGCATGGTGG + Intronic
1084744422 11:71159694-71159716 ACACCTCAGGCCGGGCATGGTGG + Intronic
1084885098 11:72199030-72199052 TCAACCCAGGCCGGGCATGGTGG + Intergenic
1085619999 11:78030771-78030793 CCAGCCCAGGCTTGGCAGCCTGG + Intronic
1086234397 11:84610624-84610646 CCTCCCCTGGCCTGGCCTCCAGG + Intronic
1088764833 11:112963838-112963860 CCTCCCCTGCCTGGGCATCCAGG - Intronic
1089810973 11:121130925-121130947 CCATCCCCGGCCGGGCATGGTGG + Intronic
1090158159 11:124463520-124463542 CCAGCCCAGGGAGAGCATCCTGG + Intergenic
1090386446 11:126360023-126360045 CCAGCCCAGGACGGGCATCAAGG - Intronic
1091321560 11:134655791-134655813 ACCCCCAAGGCCGGCCATCCTGG - Intergenic
1091928001 12:4371019-4371041 CCAGGCCAGCCCGGGCCTCCAGG - Intronic
1092120058 12:6037626-6037648 CCACACCAGGACAGGCACCCAGG - Intronic
1100517442 12:95341982-95342004 CCACCCCAGGCTGGGTATGGTGG - Intergenic
1102063400 12:109952442-109952464 CCTCCCCAGACATGGCATCCTGG + Intronic
1102128929 12:110509559-110509581 CCATCCCAGGCTGGGCATGGTGG - Intronic
1102301765 12:111776471-111776493 CAAACCCAGGCCGGGCATGGTGG + Intronic
1102429899 12:112875149-112875171 CCACCTCAGCCTGGGCAGCCAGG + Exonic
1102547271 12:113666007-113666029 CCACCCCAGGCCAGGCTCACTGG - Intergenic
1102768635 12:115453757-115453779 GCACTCCAGCCTGGGCATCCTGG - Intergenic
1102869925 12:116406165-116406187 CAACCCCTGGCCTTGCATCCTGG - Intergenic
1102953914 12:117047307-117047329 CAGCCCCAGGCCTGGCATCAGGG + Intronic
1103222765 12:119259606-119259628 CCCTCCAAGGCCGGGCATCGTGG - Intergenic
1103332437 12:120163507-120163529 CCACCACAGGCTGGGTCTCCTGG - Intronic
1103412165 12:120720138-120720160 CCACCCCAGCCTTGGCTTCCTGG - Exonic
1104810464 12:131617334-131617356 CCACTCCAGGCCGTGCATTCGGG - Intergenic
1104841816 12:131829225-131829247 CCACCCCAGGTCGGCCAGGCTGG + Intronic
1104847608 12:131854533-131854555 CCACCCCAGGGAGGTCAGCCTGG + Intergenic
1104953792 12:132454153-132454175 CACCCCCAGCCCGGGCCTCCTGG + Intergenic
1104980662 12:132571875-132571897 CCTCCTCAGACCGGGCCTCCGGG - Intronic
1105267677 13:18836751-18836773 ACATCCCAGACCGGGCAGCCGGG + Intergenic
1105717899 13:23085268-23085290 CCATTCCAGGCCGGGCATGGTGG + Intergenic
1107122310 13:36809205-36809227 CCACCCCTGGCCGGGCACAGTGG + Intergenic
1107145962 13:37060432-37060454 TCACCCCAGGCCGTGCATGATGG - Intergenic
1107833497 13:44395315-44395337 CCACCCAAGGCCGGGCACGGTGG + Intronic
1108717957 13:53100579-53100601 CCATCCCAGGCCTGGCAGGCAGG - Intergenic
1111951267 13:94711353-94711375 GCACCCCAGCCCGGGCAACCCGG - Exonic
1113788574 13:113015636-113015658 GCACCCCAGGCCGGGCCTTGGGG + Intronic
1114092557 14:19302524-19302546 CCACCCGAAGCCCGCCATCCCGG - Intergenic
1115635737 14:35288778-35288800 CCATCACAGGCCAGGCATGCTGG + Intronic
1117412002 14:55458522-55458544 CCTCCCCAGGCCAACCATCCAGG + Intergenic
1118339026 14:64879629-64879651 CCACCCCACGCCCGACAACCGGG + Intronic
1118453261 14:65923418-65923440 CCACCGTAGGCCGGGCATGGTGG - Intergenic
1119557989 14:75567960-75567982 CCACCCCAGGCAGGGCTGGCTGG + Intergenic
1119725209 14:76918189-76918211 GCCCCGGAGGCCGGGCATCCAGG + Intergenic
1119848177 14:77846443-77846465 TCACACCAGGCCTGGCTTCCAGG - Intronic
1121175315 14:91886674-91886696 TCACTCCAGGCCTGGCACCCAGG - Intronic
1121622724 14:95361469-95361491 CCACCCCAGGCTGGCCTACCTGG - Intergenic
1121645813 14:95516558-95516580 CGGCCCCAGGCCTGGCCTCCCGG + Intronic
1123937209 15:25199786-25199808 TCAACCCAGGCGGGGCACCCTGG + Intergenic
1125586657 15:40825487-40825509 CCACACCAGGCTGCACATCCAGG + Intronic
1127995551 15:64151645-64151667 CCACCCCAGGCCCCGCCCCCAGG - Intergenic
1128023948 15:64418397-64418419 ATATCCCAGGCCGGGCATCGTGG - Intronic
1128086920 15:64893127-64893149 ACACCCCAGGCTGGGCCTCATGG + Intronic
1128139121 15:65286530-65286552 CCACCCCAGGCTTGGGAACCCGG - Exonic
1128359429 15:66950745-66950767 CCACCCAAGCCCTGGCAGCCAGG - Intergenic
1128784534 15:70385183-70385205 CCACACCAGGCCAGGCACCTCGG + Intergenic
1131873130 15:96780644-96780666 CCTCCCCAGGCCTGGCTTTCTGG + Intergenic
1132307707 15:100829060-100829082 GCACTCCAGGCCGGGCATGGTGG + Intergenic
1132465208 16:74270-74292 CCAGCCTAGTCTGGGCATCCAGG - Intronic
1132698245 16:1211415-1211437 CCACCCCACACCGGACTTCCTGG - Intronic
1132958657 16:2610259-2610281 CCACCGCAGGCCAGGCAGGCCGG - Intergenic
1133035495 16:3031653-3031675 CCTCCCCACGCTGGGCATCTGGG - Intronic
1134176725 16:12012988-12013010 CCACCCCAACCCATGCATCCTGG - Intronic
1136295104 16:29297161-29297183 CGAGCCCAGGCCTGGCTTCCGGG + Intergenic
1137734919 16:50716717-50716739 TCACCCCAGGTCGTGCAGCCTGG + Intronic
1138166059 16:54802683-54802705 TCACCCCAGGCTGCGTATCCTGG - Intergenic
1138307290 16:55989281-55989303 ACACCCCAGACGGGGCAGCCGGG - Intergenic
1138434264 16:56988626-56988648 CCACCCCAGGCCTGGGAGGCAGG + Intergenic
1138473042 16:57253767-57253789 CCACCACAGCCCAGGCATGCTGG + Intronic
1140518148 16:75559391-75559413 CCAGCCAAGGCCGGGCATGGTGG + Intergenic
1141064963 16:80906952-80906974 CCAACCCAGGCTGGGCATGGGGG - Intergenic
1141150195 16:81559119-81559141 CCTCCACAGGCCGGGCATGCTGG + Intronic
1141696818 16:85624167-85624189 CCACCCCAGGGCGGGCACTGAGG - Intronic
1141875273 16:86819822-86819844 CCACCCCCAGCCGGGGATGCTGG + Intergenic
1142070198 16:88087653-88087675 CCACCCCAGGCCGTGCAGGCTGG + Intronic
1142101004 16:88271170-88271192 CGAGCCCAGGCCTGGCTTCCCGG + Intergenic
1142211772 16:88811819-88811841 CCACCCCAGGCGTGGTATTCAGG - Exonic
1142219690 16:88847941-88847963 CCACCCATGGATGGGCATCCGGG - Intronic
1142429799 16:90019689-90019711 CCGACCCCGGCCGGGCGTCCGGG + Intronic
1142519518 17:495045-495067 ACACCCCAGGCCCCGCATGCTGG + Intergenic
1142668345 17:1475131-1475153 GCACCCCAGGCCGGGCACAGTGG + Intronic
1143085850 17:4415612-4415634 ACACCACAGGCCGGGCATGGTGG - Intergenic
1143594023 17:7903394-7903416 CCAGCCCAGGCCGCACAACCAGG - Exonic
1143774125 17:9186564-9186586 CCACCCCAGGCTGGGGCTGCTGG - Intronic
1144103168 17:11961961-11961983 CCACAGCAGGCCTGGCAGCCTGG + Exonic
1144726207 17:17503958-17503980 GGATCCCAGGCCGAGCATCCTGG + Intergenic
1145241572 17:21243499-21243521 CCTCCCCAGGCCCGGCTCCCTGG + Intronic
1146654454 17:34626806-34626828 CCACCCCGGGCCCGGCCCCCCGG - Intronic
1147253363 17:39166541-39166563 CCTCCTCAGGCCTGGCCTCCTGG - Intronic
1147731879 17:42609277-42609299 CGACCCCAGGCCCGGCTTCGGGG - Exonic
1147863973 17:43541060-43541082 CCCCTCCAGGCCCGGAATCCAGG + Intronic
1148103159 17:45105019-45105041 ACACCCTGGGCCGGGCAGCCTGG - Intronic
1148372190 17:47108581-47108603 CCTCCCCAGGCCGGGCACGGTGG - Intergenic
1148685472 17:49498146-49498168 ACATCCCAGGCCAAGCATCCTGG - Intronic
1148985992 17:51621858-51621880 CCATTCCAGGTCTGGCATCCAGG + Intergenic
1149029159 17:52064449-52064471 CAGCCCCAGGCTGGCCATCCTGG + Intronic
1149680667 17:58504865-58504887 CCAGCACAGGCCGGCCTTCCCGG + Exonic
1150214527 17:63459357-63459379 GCACCCAAGGCCGGGCATGATGG - Intergenic
1151448287 17:74181497-74181519 CCACCCCAGGCTGGGAAGACTGG + Intergenic
1152198986 17:78934263-78934285 CCTCCCCTGGCCAGGCTTCCAGG - Intergenic
1152654882 17:81514825-81514847 CTGCCCCGGGCCGGGCTTCCCGG - Intronic
1152666331 17:81571868-81571890 CCACCCCAGAACAGGCACCCAGG - Intronic
1152830343 17:82493461-82493483 CCACTCCAGGCCCGGTGTCCTGG + Intergenic
1153579407 18:6557209-6557231 CCGCTCCTGGCCTGGCATCCTGG + Intronic
1153623146 18:6998743-6998765 CCACGACAGGCCGGGCATGGTGG + Intronic
1153636387 18:7117265-7117287 CCACCCCCGCCCGCGCAGCCGGG + Intronic
1153794549 18:8609969-8609991 CGACCCTGGGCCGGGCCTCCTGG + Intronic
1157570758 18:48710470-48710492 CCACCCCAGGCCGCTCATAATGG + Intronic
1160216118 18:76933179-76933201 CCAGCCGAGGCCGGGCATGGTGG + Intronic
1160842996 19:1154787-1154809 CCAACCCGGGCCCGGCACCCAGG + Intronic
1160880572 19:1318112-1318134 CCACCCCAGCCCTGGCACCCAGG + Intergenic
1160888777 19:1365857-1365879 CCTCCCCAGTCCTGGCCTCCCGG - Intronic
1160905571 19:1450241-1450263 CCACCCCGGGCCGGGATTTCCGG + Intronic
1160986973 19:1843553-1843575 CCACTCCAGGCCAGGCAGGCAGG + Intronic
1161041219 19:2111635-2111657 CCGCCCCACGCCGGGGTTCCTGG - Intronic
1161194311 19:2977658-2977680 CCTTCCCCGGCCGGGAATCCTGG - Intronic
1161395615 19:4043596-4043618 CCACCCCAGGCCCAGAATCGAGG - Intergenic
1162261104 19:9534880-9534902 TCATCCCAGGCCGGGCATGGTGG - Intronic
1162357482 19:10194997-10195019 CCACCCCAGTCCGGGCGTGGGGG + Exonic
1163584002 19:18154258-18154280 CCTCCCCAGGCTGGGACTCCTGG + Intronic
1163737367 19:18989838-18989860 CAACGCCAGGACAGGCATCCTGG + Intergenic
1163958255 19:20663999-20664021 CCATCCAAGGCCGGGCATGGTGG - Intronic
1165110414 19:33498915-33498937 CCACCCCAGGCTGCCCCTCCAGG + Intronic
1165212519 19:34247233-34247255 GCACCCTAGGCCGGGCATGGTGG - Intergenic
1165268217 19:34679268-34679290 CCACCCCAGTCCGAGCCACCTGG + Intronic
1165428147 19:35756793-35756815 CCTCCCCAGGCCTGGCACCTGGG + Exonic
1166404680 19:42511503-42511525 CCTCCCCTGGCAGGGAATCCTGG - Intronic
1167035812 19:46994416-46994438 CCAGCCCAGCCCGTGCACCCTGG - Intronic
1167073465 19:47234318-47234340 ACACCACAGGCCGGGCATGGTGG + Intergenic
1167148873 19:47697763-47697785 CCAACCTAGGCCGGGCATGGTGG - Intronic
1167327884 19:48836509-48836531 CCCCCCGAGGCCGGACTTCCAGG - Exonic
1168288513 19:55346130-55346152 CCACACCTGGCCGGGCACCCTGG - Intronic
1168322228 19:55517425-55517447 CCACCCCAGACCCGGCCTCCCGG + Exonic
925402390 2:3585028-3585050 TAACCCCAGGCCAGGCATGCTGG - Intergenic
925991611 2:9259426-9259448 GCACCCCAGCCTGGGCAGCCTGG - Intronic
926310300 2:11670054-11670076 CCACGCCCAGCCGGGCGTCCAGG + Exonic
927437741 2:23084712-23084734 CTACCCCAGGCATGGCAGCCAGG - Intergenic
927809414 2:26173237-26173259 CCAGCGCAGGCCGGCCAGCCCGG - Exonic
927844046 2:26462231-26462253 CCATCCCAGCCCTGGCACCCTGG - Intronic
927937899 2:27085847-27085869 CCAGCCCAGCCCGGGCACCCTGG + Exonic
929810265 2:45183647-45183669 CCTCCCCATGCAGGGGATCCTGG - Intergenic
931463503 2:62467817-62467839 CCACCCCAGGCCCTGCCACCTGG - Intergenic
933374967 2:81467423-81467445 GCAGCCAAGGCCGGGCAGCCAGG - Intergenic
934557616 2:95295856-95295878 CCAGCTCAGGGCCGGCATCCTGG - Intergenic
934757204 2:96832559-96832581 CCACAGCAGGCCCGGCGTCCCGG + Exonic
937045696 2:118850285-118850307 CCGGCCCAGGCCGGGCCTCGGGG - Intergenic
937256428 2:120559215-120559237 CCAGCCCAGGCCGGGCACAGTGG - Intergenic
937323239 2:120973395-120973417 CCAACCCTGGCCGGCCATACAGG + Intronic
937954569 2:127414882-127414904 CCACCCCAGGCAGGGCAGGGAGG - Intergenic
938898578 2:135777597-135777619 CCACCTCAGGCCAGGCATGGTGG + Intronic
939321795 2:140632773-140632795 CCACATTAGGCCGGGCATCGTGG + Intronic
939867437 2:147488638-147488660 CCTCCCCAGGCTGGGATTCCAGG + Intergenic
940898974 2:159108893-159108915 CCACCCCAGGCAAGGCTTTCTGG - Intronic
940908431 2:159189358-159189380 ACAGCCCAGGCTGGGCATGCAGG + Intronic
941538026 2:166745252-166745274 CCACCACAGGCCGGGCACAGTGG - Intergenic
941901622 2:170684319-170684341 CAACCCCTGGCCGGGCACCGTGG + Intergenic
941905491 2:170714366-170714388 ACAGCCCAGCCCGGGCCTCCTGG + Exonic
942639519 2:178047172-178047194 TCACCCAAGGCCGGGCATGGTGG + Intronic
946225720 2:218263140-218263162 CCACCCCAGAGCGGGCAGACTGG - Exonic
947503716 2:230690996-230691018 CCACCCCAGGCAGTGCCTGCTGG - Intergenic
947909060 2:233789799-233789821 CCACCACCAGCCGGGCCTCCAGG - Intronic
948196832 2:236103014-236103036 CACCCCCAGGCCTGGCCTCCTGG + Intronic
948636433 2:239340788-239340810 CCCCTCCAGGCCAGGCACCCTGG + Intronic
948642887 2:239386481-239386503 CCTCCCCTGGCCGGCCACCCCGG - Intronic
948770364 2:240248600-240248622 CCGCCCCAGGTCAGGGATCCAGG + Intergenic
949045240 2:241869862-241869884 CCACCGCCGTCCAGGCATCCCGG - Exonic
1168997934 20:2146584-2146606 CCTCCCCTGGCCAGGCCTCCTGG + Exonic
1169091276 20:2862716-2862738 CCTCCCCGGCCCGGCCATCCAGG - Intronic
1169211281 20:3767534-3767556 CCACCCCAGCCCTGCCATCACGG + Intronic
1171506680 20:25642100-25642122 GCACTCCAGGCCGGGCATGGTGG - Intergenic
1172815733 20:37684574-37684596 CCACACCAGGCTGGGCAACATGG - Intergenic
1172964486 20:38824740-38824762 CCATCCCAGGCTGGGCATGGCGG + Intronic
1174420231 20:50394637-50394659 CCATCCCAGACCCGGGATCCAGG + Intergenic
1175105078 20:56609427-56609449 CCAAGCCAGGCCTGGCATCTGGG + Intergenic
1175812867 20:61868226-61868248 CCTTCCCAGGGCGGGCATCCTGG + Intronic
1175943885 20:62550042-62550064 CCACCCCCGGCCCTGCAGCCTGG + Intergenic
1176171535 20:63698508-63698530 CCGCTCCAGCCCGGGCATCCTGG - Exonic
1179546134 21:42113392-42113414 CCTCCCAAGCCCGGGCTTCCTGG - Intronic
1179831751 21:44001269-44001291 CTACCCCAGGGCGGCCATCGTGG + Intergenic
1179885063 21:44310358-44310380 ACACCCCAGGCAGGGGCTCCAGG - Intronic
1180127585 21:45802738-45802760 GGACCCCAGGCAGGGCCTCCAGG + Intronic
1180488172 22:15820042-15820064 CCACCCGAAGCCCGCCATCCCGG + Intergenic
1180756971 22:18169007-18169029 CCACACCAGGCCAGGCATTAAGG + Intronic
1180843492 22:18969982-18970004 CCACCCCAGGGAGGGGACCCAGG - Intergenic
1180843680 22:18970549-18970571 CCAGCCCCGGGCCGGCATCCAGG - Intergenic
1180875507 22:19173353-19173375 CCAGCACTGGCCGAGCATCCTGG + Intergenic
1180918232 22:19504584-19504606 CCAGCCCAGGCCGGGCACAGTGG - Intronic
1181074800 22:20368435-20368457 CCACACCAGGCCAGGCATTAAGG - Intronic
1181522608 22:23458306-23458328 CCAACCCAGGGCTGGCAACCTGG - Intergenic
1182455568 22:30448143-30448165 CCACCCCAGGCCTGGGCTGCAGG + Intronic
1182826020 22:33265521-33265543 TCACTCCAGGCCGGGGATCATGG - Intronic
1183164271 22:36135655-36135677 CCACCCCCACCCTGGCATCCAGG - Intergenic
1183480318 22:38060635-38060657 CTCCCCCAGGCCTGGCCTCCTGG + Intronic
1183685522 22:39359332-39359354 CCCCCCCAGGCCGGGCACGGTGG + Intronic
1183942264 22:41302323-41302345 CCACGCGAGCCCGGGGATCCGGG + Intronic
1183951911 22:41357111-41357133 CCACCCCAGGCTGTCCATCTGGG - Intronic
1184476718 22:44726168-44726190 CCACCCCAGGCAGTGCGTCCAGG + Intronic
1184764462 22:46564293-46564315 CCACCCCACCCAAGGCATCCAGG + Intergenic
1185004153 22:48265481-48265503 ACACCCCAGGCCTGGCGTGCCGG - Intergenic
1185048963 22:48543814-48543836 TCCCTCCAGGCGGGGCATCCGGG + Intronic
949997748 3:9632052-9632074 CAATCCCAGGCCGGGCATGGTGG + Intergenic
950247460 3:11434419-11434441 CCAACCCATGCTGGCCATCCTGG + Intronic
950443540 3:13023334-13023356 CCAGCCCAGGCCAGGCAGCTGGG + Intronic
950863710 3:16172443-16172465 CCACCCCAGGGCTGTCACCCTGG - Intergenic
953350219 3:42209822-42209844 CCACACCGGGCCGGGGGTCCAGG - Exonic
956735941 3:72238344-72238366 CCACTCCAGGGCTGGCCTCCTGG - Intergenic
959936916 3:112038767-112038789 CAACACCAGGCCGGGCACCATGG - Intronic
960311139 3:116117847-116117869 CTACCTCAGGCAGGTCATCCAGG - Intronic
960533302 3:118789265-118789287 CCACCCCAAATCGGGCATCCAGG + Intergenic
960944701 3:122958144-122958166 CCAGCCCAGGCCTGACAGCCAGG + Intronic
962549534 3:136475500-136475522 CCAACTCAGGCTTGGCATCCAGG + Intronic
963129994 3:141849143-141849165 CCACTCGAGGCCGGGCATGGTGG - Intergenic
966620706 3:181960865-181960887 TCACCCCAAGCCAGGAATCCAGG - Intergenic
967387072 3:188922385-188922407 TCAACCCAGGCCTAGCATCCAGG + Intergenic
968438713 4:610505-610527 CCACCCCAGGAAAGGCCTCCAGG + Intergenic
968638999 4:1700852-1700874 CCACCCCTGGCCTGTCATGCAGG + Intronic
969082063 4:4626668-4626690 CCATCCCAGGCTGGGCATGGTGG - Intergenic
969558313 4:7928907-7928929 CCACACCTGGCTGGGCATGCTGG - Intronic
980940656 4:139271236-139271258 CCAGACCAGGCCGGGCATGGTGG + Intronic
981171960 4:141636240-141636262 CCAGCCCAGCCCGGGTCTCCAGG + Intergenic
984988416 4:185353756-185353778 CCAACCCAGGCCGGGCACGGTGG + Intronic
985238000 4:187898159-187898181 ACACCCTAGGCCGGGCATGGTGG + Intergenic
985639640 5:1057711-1057733 TCACCTCCGGCCTGGCATCCCGG - Intronic
985702983 5:1384734-1384756 CCACCCAGGGTCGGGCATCGGGG - Intergenic
986216298 5:5722292-5722314 CCACCCCAGGAAGGGCCTTCAGG - Intergenic
986370342 5:7073972-7073994 CCAGCCCTGGCCGGGCATGGTGG + Intergenic
986813536 5:11384668-11384690 CCTCCAGAGGCCGGGCAGCCTGG - Exonic
987357407 5:17076619-17076641 CAAACACAGGCCGGGCATCGTGG + Intronic
988340020 5:29959437-29959459 CCACCCCAGCACTGGCATCATGG + Intergenic
988999531 5:36745572-36745594 CCACCCCAAGCTGGGCCACCTGG - Intergenic
989977905 5:50608026-50608048 ACTTCCCAGGCCGGGCAGCCAGG - Intergenic
998146728 5:139733458-139733480 CCACCCCAGGCTGGGCAGGGCGG + Intergenic
998391859 5:141792342-141792364 CCAACTCTGGCCGGGCATGCTGG + Intergenic
999753419 5:154647109-154647131 CCTCCTCAGCCCGGGCCTCCGGG - Intergenic
1000581566 5:163040794-163040816 CAACCCCAGGCAGGGCAGCATGG + Intergenic
1001319547 5:170668980-170669002 CCAGCCCAGCCTGGGAATCCAGG - Intronic
1001712443 5:173789450-173789472 GCACCCCAGGCCCAGCCTCCTGG - Intergenic
1001939180 5:175728863-175728885 CCAGACCAGGCTGGGCTTCCTGG - Intergenic
1002000954 5:176195999-176196021 GCACCCCAGGCCCAGCTTCCTGG - Intergenic
1002061914 5:176630279-176630301 CCAGCCCCGGCCCCGCATCCAGG - Exonic
1002253380 5:177942973-177942995 GCACCCCAGGCCCAGCTTCCTGG + Intergenic
1006182710 6:32163753-32163775 CCACCCTAGACCAGGCATCTGGG - Intronic
1006885685 6:37380381-37380403 CCAACCCAGGCCGGGCTTGGTGG + Intronic
1006982104 6:38155000-38155022 CCACCCTAGGAAGGGCCTCCAGG + Intergenic
1007597642 6:43061331-43061353 CAACACCAGGCCTGACATCCTGG - Exonic
1007736125 6:43983332-43983354 CACCCCCAGGCCAGGCCTCCAGG - Intergenic
1007752223 6:44077360-44077382 CCACACCAGGCCAGCCATCATGG + Intergenic
1007967153 6:46014019-46014041 CCACCCCAGGCTGGATTTCCAGG - Intronic
1011629657 6:89311537-89311559 CCACCCATGGCAGGGCAGCCAGG + Intronic
1013242769 6:108261160-108261182 CCAGCCTCGGCCGGGCCTCCCGG - Exonic
1013467594 6:110430886-110430908 CTTCCCCAGGCCTGGCTTCCAGG + Intronic
1014514266 6:122361888-122361910 TCCCCCCAAGCCGGGCATCTTGG - Intergenic
1017020058 6:150132988-150133010 CCACCCCAGCCTGGGCAACAGGG - Intergenic
1017027914 6:150197692-150197714 GCACACAAAGCCGGGCATCCAGG - Intronic
1017027930 6:150197740-150197762 GCACACAAAGCCGGGCATCCAGG - Intronic
1017027946 6:150197788-150197810 GCACACAAAGCCGGGCATCCAGG - Intronic
1017027961 6:150197836-150197858 GCACACAAAGCCGGGCATCCAGG - Intronic
1017027990 6:150197932-150197954 GCACACAAAGCCGGGCATCCAGG - Intronic
1017028005 6:150197980-150198002 GCACACAAAGCCGGGCATCCAGG - Intronic
1017028035 6:150198076-150198098 GCACACAAAGCCGGGCATCCAGG - Intronic
1017028050 6:150198124-150198146 GCACACAAAGCCGGGCATCCAGG - Intronic
1017028065 6:150198172-150198194 GCACACAAAGCCGGGCATCCAGG - Intronic
1017028081 6:150198220-150198242 GCACACAAAGCCGGGCATCCAGG - Intronic
1017028096 6:150198268-150198290 GCACACAAAGCCGGGCATCCAGG - Intronic
1017028112 6:150198316-150198338 GCACACAAAGCCGGGCATCCAGG - Intronic
1017028128 6:150198364-150198386 ACACACAAAGCCGGGCATCCAGG - Intronic
1017185331 6:151594936-151594958 CCACTCCAGGCTGGGCATGGTGG - Intronic
1017734484 6:157348595-157348617 CCATCCCAGGCTGGGCATGGTGG - Intergenic
1018029248 6:159829154-159829176 CCATCCCAGGCTGGGCAACATGG + Intergenic
1018064350 6:160115222-160115244 CCAGGCCAGGCCTGTCATCCAGG - Intergenic
1018282129 6:162198293-162198315 GCTCCCCAGGCCCAGCATCCTGG - Intronic
1019588719 7:1818238-1818260 CCAACCCAGGGCTGGCAACCTGG + Intronic
1019934275 7:4244165-4244187 CCACCCAAGGCCTGGTTTCCTGG + Intronic
1020206681 7:6123234-6123256 CCACCCCAAGCTGGGCATGATGG + Intronic
1020273651 7:6612194-6612216 CTAGCCCAGGCCGGGCATGCTGG + Intergenic
1020654102 7:10909359-10909381 CCAAGCAAGGCAGGGCATCCTGG - Intergenic
1021807811 7:24374291-24374313 CAATGCCAGGCCGGGCATGCTGG - Intergenic
1022963254 7:35450328-35450350 CCATCCCAGGCTGGACATGCAGG + Intergenic
1023055939 7:36290221-36290243 CCACCCCACCCCTGGTATCCAGG + Intronic
1023412372 7:39900779-39900801 CCACACCTGGCCTGGAATCCAGG + Intergenic
1023849524 7:44142267-44142289 CCACCCCAGGCTGGGCTCACTGG + Intergenic
1023859959 7:44212694-44212716 CCACCCCAGCCCTAGCATCAGGG - Exonic
1024256897 7:47546079-47546101 CCACCTCAGTCCAGGCCTCCTGG - Intronic
1025811797 7:64880392-64880414 CCTCCCCAGGAGGGGCTTCCTGG + Intronic
1026062444 7:67038316-67038338 CCACACCAGGCCGGGCTTGGTGG + Intronic
1027707129 7:81549073-81549095 ACACTCCAGGCCGGGCATGGTGG - Intergenic
1029280124 7:99430057-99430079 CCACTCCAGGCCTGGGGTCCTGG + Intronic
1029600489 7:101560434-101560456 CCACACCAGGCCAGGCATGGTGG + Intergenic
1029698328 7:102229215-102229237 CCAACCCAGGCCGAGCACCCAGG - Intronic
1031571471 7:123365139-123365161 GAACCCCAGGCCGTGCCTCCTGG + Intergenic
1032710870 7:134459009-134459031 CAACCCCAGGATGGGCATCTTGG + Exonic
1034501741 7:151455126-151455148 GAACCCCAAGCCGGGCATGCAGG - Intergenic
1035413714 7:158666964-158666986 GCACGCCAGGCCCGGCAGCCTGG + Intronic
1035459751 7:159031464-159031486 CCAACCCAGGCCCGGCTTTCTGG + Intronic
1036038204 8:5043262-5043284 TCACCCCAGGCTGTGCAACCCGG + Intergenic
1036295063 8:7528721-7528743 CCTCACCAGCCCGGGCCTCCGGG + Intergenic
1036327500 8:7792270-7792292 CCTCACCAGCCCGGGCCTCCGGG - Intergenic
1036482381 8:9150659-9150681 CCAGCCCAGGCCCTGCCTCCCGG - Exonic
1036775108 8:11606268-11606290 CCACCCCAGGCCAGGCTTTCGGG + Intergenic
1037360484 8:18068783-18068805 CCACCCCAGGCCGGGCATCCTGG + Intronic
1037360497 8:18068836-18068858 CCAACCCAGGCCGGGCATGGCGG + Intronic
1040913762 8:52547208-52547230 TTACCCCAGGCCGGGCATGGTGG + Intronic
1041478451 8:58292112-58292134 CCACCACAGGCAGAACATCCAGG - Intergenic
1044819263 8:96144952-96144974 GCAGCCAAGGCCTGGCATCCGGG + Exonic
1046606349 8:116375563-116375585 CCACCCCAGGCCTGTCATAGGGG + Intergenic
1049004723 8:139847523-139847545 CATCCCCAGGCCGGGCCTCCAGG - Intronic
1049177922 8:141205756-141205778 CCACCCGAGGGCGGGGGTCCTGG + Intergenic
1049470708 8:142773991-142774013 CCACCCCAGGCCTGGGAAGCAGG - Intronic
1049778994 8:144418989-144419011 GCACTCCAGCCCGGGCAACCTGG + Intergenic
1050019395 9:1268048-1268070 CTGCCCCAGGCCGTGCAGCCTGG + Intergenic
1055453158 9:76449038-76449060 CCACCCCAGGCTGGGCATGGTGG + Intronic
1056232861 9:84564842-84564864 CCTCCCCCTGCTGGGCATCCTGG + Intergenic
1056752927 9:89364810-89364832 CCTCCCCAGGCGAGGCAGCCTGG - Intronic
1056815166 9:89795922-89795944 CCCTCCCAGGCTAGGCATCCAGG + Intergenic
1057366154 9:94423222-94423244 CAATCCCAGGCTGGGCATTCTGG - Intronic
1057547873 9:96031613-96031635 CCACCCCAGCCCCTGGATCCTGG - Intergenic
1057657177 9:96964841-96964863 CAATCCCAGGCTGGGCATTCTGG + Intronic
1059207224 9:112477982-112478004 CCACCCCTGGCCGGGCATGGTGG - Intronic
1059342393 9:113605176-113605198 CCACCCCAGGCCGGGCGCAGTGG + Intergenic
1059450320 9:114367633-114367655 CCACCCCAGGGTGGGCATGCTGG + Exonic
1060027790 9:120187583-120187605 CTTCCCCAGGCTGGGAATCCTGG - Intergenic
1060658083 9:125386645-125386667 CCACTCCAGGCCAGGCATGGTGG + Intergenic
1061132449 9:128715485-128715507 ACAGCCCAGGCCAGCCATCCTGG - Intronic
1061331624 9:129898115-129898137 CTAGCCCAGGCCGGGCATGGTGG - Intronic
1062035600 9:134381245-134381267 CCAGCCCAGGCCGGGCAACCTGG - Intronic
1062075999 9:134590335-134590357 CCACCCTTGGCCGGGCACCATGG - Intergenic
1062236918 9:135514805-135514827 CCACCCCAGAGAGGGCTTCCTGG + Intergenic
1062274480 9:135724241-135724263 CCACCCCCAGCCTGGCCTCCGGG - Intronic
1062289277 9:135787283-135787305 CCACGCCAGGCAGGGCATGTAGG - Intronic
1062294697 9:135818197-135818219 CCACCCCATCCCGGGGAGCCGGG + Intronic
1062491875 9:136808620-136808642 CACCCCCGGGCCGGGCAGCCGGG - Intronic
1062523805 9:136970294-136970316 CCTCCCCAGGCAGGGGTTCCAGG - Intronic
1185737238 X:2502750-2502772 GGACCCCAGACCTGGCATCCGGG + Intronic
1187062315 X:15798898-15798920 CCACCCAGGGCCGGACATGCTGG + Intronic
1190245178 X:48686098-48686120 CCACCCCTGCCCCTGCATCCAGG + Exonic
1191859163 X:65651961-65651983 CCATCCCAGGCCAGGCATGGTGG + Intronic
1192455652 X:71273408-71273430 GCACCCCAGCCTGGGCAGCCTGG + Intergenic
1197843426 X:130775178-130775200 CCAGACCAGGCTGGGCAACCTGG + Intronic
1201012339 Y:9560136-9560158 CAACTCCAGGCCGGGCATGGTGG + Intergenic