ID: 1037376215

View in Genome Browser
Species Human (GRCh38)
Location 8:18232738-18232760
Sequence CAGTATCTGCTTCTTTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037376215_1037376217 8 Left 1037376215 8:18232738-18232760 CCTTAAAAAAGAAGCAGATACTG No data
Right 1037376217 8:18232769-18232791 AACCACATAGATGAAACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037376215 Original CRISPR CAGTATCTGCTTCTTTTTTA AGG (reversed) Intergenic
No off target data available for this crispr