ID: 1037378490

View in Genome Browser
Species Human (GRCh38)
Location 8:18258708-18258730
Sequence TGGGAGAAGGATAGTGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037378487_1037378490 -7 Left 1037378487 8:18258692-18258714 CCATCTAGATTCTATTTGGGAGA No data
Right 1037378490 8:18258708-18258730 TGGGAGAAGGATAGTGAGATGGG No data
1037378484_1037378490 27 Left 1037378484 8:18258658-18258680 CCTTTATAGAGATTTTGATGTTT No data
Right 1037378490 8:18258708-18258730 TGGGAGAAGGATAGTGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037378490 Original CRISPR TGGGAGAAGGATAGTGAGAT GGG Intergenic
No off target data available for this crispr