ID: 1037379536

View in Genome Browser
Species Human (GRCh38)
Location 8:18269842-18269864
Sequence GTCAATTTATTAGGAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037379536_1037379540 18 Left 1037379536 8:18269842-18269864 CCAGTCTTTCCTAATAAATTGAC No data
Right 1037379540 8:18269883-18269905 TTATTTTGATTATTTGTCATGGG No data
1037379536_1037379539 17 Left 1037379536 8:18269842-18269864 CCAGTCTTTCCTAATAAATTGAC No data
Right 1037379539 8:18269882-18269904 TTTATTTTGATTATTTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037379536 Original CRISPR GTCAATTTATTAGGAAAGAC TGG (reversed) Intergenic
No off target data available for this crispr