ID: 1037384001

View in Genome Browser
Species Human (GRCh38)
Location 8:18318150-18318172
Sequence CAGGCAGGGGACCTTCCCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037383996_1037384001 -1 Left 1037383996 8:18318128-18318150 CCTAGTGTCTGAAGACAGACATC No data
Right 1037384001 8:18318150-18318172 CAGGCAGGGGACCTTCCCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037384001 Original CRISPR CAGGCAGGGGACCTTCCCGT AGG Intergenic
No off target data available for this crispr