ID: 1037387096 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:18354773-18354795 |
Sequence | CTGGATACACAATTGTAGAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1037387094_1037387096 | 10 | Left | 1037387094 | 8:18354740-18354762 | CCAATTATTCTTATCTTTTGAAG | No data | ||
Right | 1037387096 | 8:18354773-18354795 | CTGGATACACAATTGTAGATTGG | No data | ||||
1037387093_1037387096 | 11 | Left | 1037387093 | 8:18354739-18354761 | CCCAATTATTCTTATCTTTTGAA | No data | ||
Right | 1037387096 | 8:18354773-18354795 | CTGGATACACAATTGTAGATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1037387096 | Original CRISPR | CTGGATACACAATTGTAGAT TGG | Intergenic | ||
No off target data available for this crispr |