ID: 1037387096

View in Genome Browser
Species Human (GRCh38)
Location 8:18354773-18354795
Sequence CTGGATACACAATTGTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037387094_1037387096 10 Left 1037387094 8:18354740-18354762 CCAATTATTCTTATCTTTTGAAG No data
Right 1037387096 8:18354773-18354795 CTGGATACACAATTGTAGATTGG No data
1037387093_1037387096 11 Left 1037387093 8:18354739-18354761 CCCAATTATTCTTATCTTTTGAA No data
Right 1037387096 8:18354773-18354795 CTGGATACACAATTGTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037387096 Original CRISPR CTGGATACACAATTGTAGAT TGG Intergenic
No off target data available for this crispr