ID: 1037390755

View in Genome Browser
Species Human (GRCh38)
Location 8:18389079-18389101
Sequence ATGTCCAGCAAGAACCGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037390755_1037390758 14 Left 1037390755 8:18389079-18389101 CCATGACGGTTCTTGCTGGACAT No data
Right 1037390758 8:18389116-18389138 GTCAAACTGACAATAATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037390755 Original CRISPR ATGTCCAGCAAGAACCGTCA TGG (reversed) Intergenic
No off target data available for this crispr