ID: 1037390949

View in Genome Browser
Species Human (GRCh38)
Location 8:18391253-18391275
Sequence CTTCCCTTGCAGACTTTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037390943_1037390949 25 Left 1037390943 8:18391205-18391227 CCTAACTAGACTCTGGTGTCAGG 0: 1
1: 0
2: 0
3: 11
4: 92
Right 1037390949 8:18391253-18391275 CTTCCCTTGCAGACTTTGGAAGG 0: 1
1: 0
2: 3
3: 20
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037390949 Original CRISPR CTTCCCTTGCAGACTTTGGA AGG Exonic
901548644 1:9978564-9978586 CTTCCTTTTCAGACTTGGCAGGG + Intronic
903330750 1:22595959-22595981 TCTCCCCTGCAGACTTTGTAAGG + Intronic
903965844 1:27088917-27088939 CTTCCCTGGCAAGCTGTGGAGGG + Intergenic
904672282 1:32174767-32174789 CTTCCCTGGCAGCCTGGGGAAGG + Exonic
906709611 1:47919476-47919498 CTTCCCTTGGAGAGATTTGAAGG - Intronic
907886516 1:58597136-58597158 TTTCCCATGCAGCCCTTGGAGGG - Intergenic
911056171 1:93710370-93710392 CTTCCCTTGGAGACCTTGAAGGG + Intronic
912082803 1:105958347-105958369 CTCCCCTTCCAGTCTGTGGAAGG - Intergenic
913046641 1:115078826-115078848 ATTCCCTTGGAGACTTGTGAAGG - Intronic
913200658 1:116493353-116493375 CTTCCCTTGCGGCCTGTGGTTGG + Intergenic
917728644 1:177852112-177852134 CTTCCCTTGCAGTTTTTTGAGGG + Intergenic
918433742 1:184489230-184489252 CTTTCCTTACAGATTTTGAAGGG - Intronic
920666665 1:207967714-207967736 CTTCCCCTATAGGCTTTGGAGGG + Intergenic
922058795 1:222067784-222067806 TTTGCCTTGCACACTTTCGAAGG - Intergenic
922626979 1:227057867-227057889 CTTGCCTTGCAGACTTTCTGGGG - Intronic
922898852 1:229121059-229121081 CTTTCCTTGGGTACTTTGGAAGG + Intergenic
924090344 1:240494643-240494665 TTTCCCTAGCTGACTTTGGGAGG + Intronic
1063009459 10:2008169-2008191 CATCCCTTGGAGGCTTTGGAGGG + Intergenic
1063138424 10:3236678-3236700 CTTCCCTTCCAGGCCTTGGCTGG + Intergenic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1069009152 10:63351751-63351773 CTTTCCTTGCAGACCTGTGAAGG - Intronic
1069347421 10:67486516-67486538 CTTCCCTACCATACTTTGGTAGG + Intronic
1071021586 10:81063642-81063664 CTTCCCCTAGAGACTTTGGAGGG + Intergenic
1072979574 10:100088586-100088608 CTTGCCTTCCAGACTTTGCTGGG - Intergenic
1073074155 10:100812943-100812965 CTTCCCTGGGCCACTTTGGAAGG + Intronic
1074189586 10:111124279-111124301 CTTGGCTTGGAGACTTGGGATGG - Intergenic
1074342803 10:112651142-112651164 CTCCCCTTGCTGACTTTCTAGGG - Intronic
1074436044 10:113435321-113435343 CTTCCCTCTCAGCCTTCGGAAGG + Intergenic
1074511108 10:114112846-114112868 CTTCCCCTGCTGACTTTGTGTGG + Intergenic
1074600360 10:114907750-114907772 TCTCCCTTAGAGACTTTGGAGGG + Intergenic
1074863375 10:117530308-117530330 CTTCCCTTGCAGGCTTTTCCTGG + Intergenic
1075117766 10:119641185-119641207 TTTCCCTTGCAGCCCTTAGAAGG + Intergenic
1076273366 10:129175721-129175743 CTTCCCCTGGAGGCTTTGGAGGG - Intergenic
1077176934 11:1195333-1195355 CTTCCCCTCCAGCCCTTGGAAGG - Intronic
1078154558 11:8788150-8788172 CTTCACTTACAGGGTTTGGATGG - Intronic
1078928463 11:15894930-15894952 TTTCCCTTAGAGCCTTTGGAGGG - Intergenic
1079876030 11:25858418-25858440 CTTTGCTTTCTGACTTTGGAGGG + Intergenic
1080976956 11:37354819-37354841 CTGCCCTTGTAGATTTTGGAAGG + Intergenic
1082639969 11:55647312-55647334 TTTCCCCTACAGACTTCGGAAGG + Intergenic
1083856683 11:65396502-65396524 CTTCCTTTGCAGAGTGGGGATGG - Intronic
1086985896 11:93248790-93248812 CTTCCCTTTCAGACACTAGAGGG - Intergenic
1089453512 11:118612547-118612569 CTTCCCTGGCAGTCTTGGGGTGG + Intronic
1089685162 11:120142009-120142031 CATCCCTTGCAAGCTTTAGAAGG + Intronic
1090403654 11:126464742-126464764 TTTCCCCTGGAGCCTTTGGAGGG + Intronic
1093054053 12:14536796-14536818 ATTCCCTTGCAGGCTGTGCATGG + Intronic
1093111169 12:15154051-15154073 CCTCCCTTACAGACTTTGGAAGG + Intronic
1094178188 12:27563568-27563590 CTGCCATTGCCGACTTTGAAGGG + Intronic
1095809310 12:46355074-46355096 GTTCCCTTGAAGACATAGGAGGG + Intergenic
1097051551 12:56226167-56226189 CTTCCCTTGCAGATTCTGTATGG + Exonic
1098298520 12:69029148-69029170 CTTCCCCTGCACACTGTGAAAGG + Intergenic
1104922053 12:132295660-132295682 CCTCCCCTGGAGACTATGGAGGG + Intronic
1108005786 13:45944921-45944943 TTTCACAAGCAGACTTTGGAGGG - Intergenic
1112569450 13:100580469-100580491 CTTTCCATACAGCCTTTGGAGGG + Intronic
1112991107 13:105514859-105514881 CTCCCCTTGGAGAGATTGGATGG - Intergenic
1113476130 13:110582606-110582628 ATTCCCCTGCAGGCTTCGGAGGG - Intergenic
1113665340 13:112137162-112137184 CTCCCCTAGCAGACGCTGGAGGG + Intergenic
1117073329 14:52075684-52075706 CTACCCTTGAAGACAGTGGAGGG - Intergenic
1118313218 14:64707986-64708008 CTACCCCTGCAGAATTTGGTTGG - Intronic
1120743415 14:88132308-88132330 CTTCCCTTGCATTGTTTTGAGGG - Intergenic
1123506304 15:20943031-20943053 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1123563530 15:21516735-21516757 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1123599782 15:21954022-21954044 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1124035741 15:26052355-26052377 CTTCCTTTGCAGGCAGTGGAAGG + Intergenic
1124140518 15:27073126-27073148 CTTCCCTATCATGCTTTGGATGG - Intronic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1128522124 15:68382390-68382412 TTTTCCTTGCAAAGTTTGGAAGG - Intronic
1129419493 15:75412758-75412780 CTCACCTTGCTGACTTTGGCAGG + Exonic
1130416098 15:83696077-83696099 TATCCCTTGCAGACTGTGGCTGG + Intronic
1132139923 15:99383825-99383847 CTCCCCTTGCAGATTCTAGAGGG - Intronic
1202971888 15_KI270727v1_random:243872-243894 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1133562185 16:6960581-6960603 CCTCCTCTGCAGAGTTTGGAAGG - Intronic
1133583357 16:7167521-7167543 CCTCCCATGCAGTCTTTGGAGGG + Intronic
1134055877 16:11169586-11169608 CCTCCTTTGCACACTTTGCATGG + Intronic
1134323648 16:13187132-13187154 GTGCCCTAGCAGACTCTGGAAGG + Intronic
1135256117 16:20942745-20942767 CTTCATTTGTAGACTTAGGAGGG + Intronic
1135485845 16:22863888-22863910 CTTCCCGTGTTGAGTTTGGAAGG + Intronic
1137705804 16:50535062-50535084 CTTCCCATCCAGACTGTGGTTGG + Intergenic
1137840385 16:51635977-51635999 GTTCTCTGGCAGAATTTGGAAGG + Intergenic
1138201422 16:55091474-55091496 CGTCCCTTGCAGAAGTGGGAGGG - Intergenic
1138604270 16:58077836-58077858 TCTCCCTTGGAGCCTTTGGAAGG + Intergenic
1139580010 16:67867454-67867476 CTGCCCTTGAAGGCTGTGGAAGG + Intronic
1140376809 16:74451318-74451340 CTTCCCTTGGTGACTTGGCAGGG + Intergenic
1140827037 16:78716296-78716318 CCTCCCCTCCAGCCTTTGGAGGG + Intronic
1141589338 16:85057440-85057462 CTGACCTTGCAGACTATGGCAGG + Intronic
1143543466 17:7582920-7582942 GTGACCTTGTAGACTTTGGAGGG + Intergenic
1143588236 17:7862881-7862903 CTTCCCATCCTAACTTTGGAAGG - Intronic
1145403623 17:22568313-22568335 CTTCTCCTGCAGTCTCTGGAGGG - Intergenic
1145885814 17:28381793-28381815 CTTGCCTTGCAGGCTCTTGATGG - Exonic
1146399624 17:32492926-32492948 CTTTCCTCCCAGCCTTTGGATGG - Exonic
1147594820 17:41710104-41710126 CTTCCCCTGCAGACCTGGCAGGG + Intergenic
1148086727 17:44998077-44998099 CTTCCCTTGAATCCCTTGGAGGG - Intergenic
1151113302 17:71704550-71704572 GTTTCCTTGGAGATTTTGGAAGG - Intergenic
1151193115 17:72413001-72413023 GTTCCTTTGCAGTCTTTTGAAGG - Intergenic
1151349538 17:73523616-73523638 CTTCCCTTACAGACTGCAGAGGG + Intronic
1152292569 17:79448570-79448592 CCTCCCCTGAAGCCTTTGGAGGG + Intronic
1154172622 18:12062170-12062192 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1154205582 18:12334099-12334121 CTGCCCTCGCAGAGTCTGGAAGG + Intronic
1154485455 18:14868318-14868340 CTTCTCCTGCAGTCTCTGGAGGG + Intergenic
1155514690 18:26612607-26612629 TCTCCCTCACAGACTTTGGAAGG + Intronic
1158194099 18:54865679-54865701 CTTCTTTTGAAGAATTTGGAGGG + Intronic
1159497262 18:69222449-69222471 CTTTCCTTGGGCACTTTGGAGGG - Intergenic
1159583857 18:70264119-70264141 CTTCCCTTGCCTGTTTTGGAGGG + Intergenic
1160009029 18:75089816-75089838 CTTCTCTTTCATACTTAGGAAGG - Intergenic
1160109986 18:76017245-76017267 TCTCCCTTACAGCCTTTGGAAGG - Intergenic
1160799046 19:959228-959250 CCTCCCTTGGAGACTTCGGAGGG + Intronic
1161464008 19:4417322-4417344 CTTCTCTTGGAGAAATTGGAAGG + Intronic
1162603189 19:11686037-11686059 TTTCTCTTCCAGTCTTTGGAAGG + Intergenic
1168379318 19:55906800-55906822 CATCCCTTTCAGAGGTTGGATGG + Intronic
925779971 2:7373077-7373099 CTCCTCTGGCAGAGTTTGGATGG + Intergenic
926106625 2:10156158-10156180 CTTCCCTTGGCCACATTGGAAGG + Intronic
926841229 2:17082610-17082632 TTTCCTCTGCAGACTTTGCATGG - Intergenic
929555761 2:42924741-42924763 CTTTTCTTGCAGGCTTTGGGGGG + Intergenic
929625970 2:43407056-43407078 CTTTCCTTGCAGGCAGTGGATGG + Intronic
930098071 2:47582156-47582178 CTTCCCTTGTAGACCTTATAGGG + Intergenic
930889690 2:56369550-56369572 TTTACCTTGCTGACTTTGAAAGG - Intronic
931427836 2:62187321-62187343 CTTCCCTTTCAGACTATTTATGG + Intergenic
933304087 2:80576119-80576141 CTTTCTTTGCAGCCTTTGGGAGG - Intronic
934057447 2:88263609-88263631 CTGCCCATTGAGACTTTGGAGGG - Intergenic
935292871 2:101624840-101624862 TTTCCCTTGCGGAATCTGGAGGG - Intergenic
935639623 2:105278644-105278666 GCACCCTTGCAGACTTTGGGAGG - Intronic
936579850 2:113689312-113689334 CTTCCCTCACAGTCCTTGGAAGG - Intergenic
937169382 2:119850408-119850430 CTTGCCCTGCAGGCTTTGGGTGG + Intronic
937207788 2:120247700-120247722 CTTTCCTTGCAGCCTTTTGCAGG - Intronic
937593026 2:123638131-123638153 CTTCCCTTGGAGAAGTTGTATGG + Intergenic
937925741 2:127166198-127166220 CTTCCCATGCACACCATGGAGGG + Intergenic
938286983 2:130127439-130127461 CTTCTCTTGCAATCTCTGGAGGG - Intronic
938428611 2:131211431-131211453 CTTCTCTTGCAATCTCTGGAGGG + Intronic
940275224 2:151932985-151933007 CTTCCCTTGCAGGCTTTAGAAGG + Intronic
941858201 2:170251649-170251671 CTTCCCTTACAGGTTTTAGAAGG + Intronic
944257040 2:197633915-197633937 GTTCCATTGCAGAATTTAGATGG + Exonic
948085426 2:235243023-235243045 CTTCCCTGCCAGACTCTGGCTGG + Intergenic
1169849328 20:10032524-10032546 GTTCCCTTCCACACTGTGGAAGG + Intronic
1170216735 20:13899547-13899569 CTTCCCTGGCAGAGGGTGGAAGG + Intronic
1170593289 20:17787279-17787301 CCTGCCCTGCAGCCTTTGGAGGG - Intergenic
1172931869 20:38592113-38592135 CTTCCTCTGCAGGGTTTGGAGGG - Intergenic
1173229711 20:41184692-41184714 CTTCCCTGCCTGACTGTGGAAGG + Exonic
1173685275 20:44919093-44919115 CCTCCCTACCAGACTTTGGAAGG - Intronic
1174439836 20:50541825-50541847 CTCTCCTTGCCGACTTTGGTTGG - Intronic
1175327610 20:58140631-58140653 CTTCCCCTGGAGGCTCTGGAGGG - Intergenic
1175333744 20:58181642-58181664 CCTACCTTGGAGGCTTTGGAAGG - Intergenic
1176795881 21:13371159-13371181 CTTCTCCTGCAGTCTCTGGAGGG - Intergenic
1178354235 21:31897361-31897383 CTTTCCTTGCAGCCCTCGGAGGG - Intronic
1178877804 21:36426149-36426171 TCTCCCCTGCAGCCTTTGGAAGG - Intergenic
1178966303 21:37122015-37122037 ATTCCCTTTCAAACTTTGGAGGG + Intronic
1182191408 22:28464596-28464618 CTTCACTTCCTCACTTTGGAAGG + Intronic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1183257311 22:36770834-36770856 CCTCCCCTGCACACTGTGGAAGG - Intronic
1183327288 22:37201169-37201191 CTTCCCTTGCAGCCCTCAGAAGG - Intergenic
1184341752 22:43890009-43890031 CTTCCCTTGGAGAGCTTGGCTGG - Intronic
1184597698 22:45524275-45524297 CTGCCCTTGCTGGCTTTGGCTGG + Intronic
949464595 3:4331326-4331348 CTTCCCTTATACACTTTCGATGG + Intronic
952378871 3:32789046-32789068 CCTCCCTTGCAGACTTGGAAGGG + Intergenic
952519865 3:34145748-34145770 CTTCCCTTGGAGAATTTTTAGGG - Intergenic
953294265 3:41696976-41696998 CTTCCCTTAGAGCCTCTGGAAGG + Intronic
954640817 3:52096781-52096803 TTTCCCTTTCATCCTTTGGAGGG - Intronic
955617378 3:60823605-60823627 ATTCCCCTGCAGATTTTAGAGGG + Intronic
955686679 3:61556289-61556311 CTTCCCTTACAGATTTCAGAGGG - Intergenic
956433302 3:69208761-69208783 TTTCCTTTGAAGTCTTTGGAGGG - Intronic
960266556 3:115626860-115626882 CTTTCCTTGCAGTGTTGGGAAGG + Intronic
960601336 3:119461998-119462020 CCTTCTTTGCAGACTTTGGTTGG - Exonic
960673021 3:120170209-120170231 CTCCCCTTGTAGAATTGGGAAGG + Intronic
961341622 3:126226641-126226663 CTTCCCTTTCAGGCTTAGCAGGG - Intergenic
962038856 3:131683641-131683663 ATTCCCTTGGTGACTTTGGCTGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964131197 3:153288702-153288724 CTTCTTTTGCTGACTTTGGCTGG + Intergenic
965785307 3:172329097-172329119 CTTGCCCTTCAGCCTTTGGATGG + Intronic
966260544 3:177973443-177973465 CTTCCCTTGCGGATTTAGTAAGG - Intergenic
966465363 3:180225578-180225600 CTTGCCTTGCAGCCAATGGAAGG + Intergenic
967384542 3:188898711-188898733 CTTCCTAAGCAGACTTTGCAAGG - Intergenic
968074760 3:195810225-195810247 CTTCTCTTGCAGCCTTTAAACGG + Intronic
969937691 4:10698634-10698656 CTTTCCTTGAAGATTTTGGTTGG - Intergenic
971035942 4:22693020-22693042 CTTTCCCTGCAGGATTTGGATGG + Intergenic
971630757 4:28990257-28990279 CTTACCTTACAGACTTCGGAGGG - Intergenic
972167670 4:36307309-36307331 CTTCCCTCACAGCCCTTGGAAGG - Intronic
972669314 4:41198765-41198787 CCTCTCCTGAAGACTTTGGAGGG - Intronic
977502114 4:97853714-97853736 CTTCTCTTGAAGAATTTGGTAGG + Intronic
977957193 4:103043308-103043330 CTTTCCTTGCAGGCATGGGATGG - Exonic
977991712 4:103451072-103451094 CTTCCTTTGCAGCCTGTCGATGG + Intergenic
983015882 4:162611361-162611383 ATTACTTTGCAGACTTTGGTAGG + Intergenic
984566062 4:181331367-181331389 CTGCCCTTGCAGCCTCTGAAGGG - Intergenic
984876881 4:184376710-184376732 CCTCCCCTGGAGGCTTTGGAGGG + Intergenic
986896448 5:12376308-12376330 CTTACCTTGAGAACTTTGGAAGG - Intergenic
989320077 5:40123724-40123746 CTTCCCTTGGCTACATTGGAAGG + Intergenic
989570304 5:42940030-42940052 ATTCCTTTGCACAGTTTGGAGGG + Intergenic
990484822 5:56247835-56247857 CCTTCCTGGCAGACTCTGGAGGG + Intergenic
992746929 5:79829458-79829480 CTCCCCTTGCCGCCTCTGGAGGG - Intergenic
992946215 5:81813152-81813174 TTTCAATAGCAGACTTTGGAAGG + Intergenic
993866468 5:93202488-93202510 CTTCCATTGCAAAGTTTTGAGGG - Intergenic
993903595 5:93600748-93600770 CTTCCCTGGGAGACATTCGAGGG - Intergenic
996771672 5:127092995-127093017 CTTTCCTTGTAGATTTTGAAGGG - Intergenic
1000048600 5:157542458-157542480 CTTCATTTCCAGGCTTTGGAAGG - Intronic
1004335147 6:14757642-14757664 CCTCCCTTGCAGACCTCAGAAGG - Intergenic
1006872105 6:37261140-37261162 CTACCATTGCAGGCTTTGGCAGG + Intronic
1010180271 6:73078636-73078658 CTTCCCTCCCACACTGTGGAAGG - Intronic
1016359325 6:143250965-143250987 CTCCCCCTGGAGACTTCGGAGGG + Intronic
1017599108 6:156061532-156061554 CTTCCCTGGGAGGCATTGGATGG + Intergenic
1017972910 6:159328742-159328764 ATTCCCTAGGAGACGTTGGAAGG - Intergenic
1018486081 6:164242361-164242383 CCTCCCCTGGAGACTTTGGAGGG + Intergenic
1021114426 7:16731772-16731794 CTGCCCTTGCAAACTGGGGACGG + Intergenic
1022533282 7:31080261-31080283 CTTGCCTTGAATACTTTGCAAGG + Intronic
1023658292 7:42448350-42448372 CTTCCCTGGCTGTGTTTGGAGGG + Intergenic
1028530055 7:91828579-91828601 TTCCCCTTGCAGACTTTAGTAGG + Intronic
1031053271 7:116967258-116967280 ATTCCCCTGCAGAGTTTGGTAGG + Intronic
1034269083 7:149794997-149795019 CTTGCCCTGCACACTGTGGATGG + Intergenic
1034999866 7:155604060-155604082 CCTCCCTTGCAGTATTTGGACGG - Intergenic
1037387613 8:18360268-18360290 CTTCCTCTGCAGACTTTGGAAGG + Intergenic
1037390949 8:18391253-18391275 CTTCCCTTGCAGACTTTGGAAGG + Exonic
1038344410 8:26718904-26718926 CCTCCCTTCCAGACTCTGGCAGG + Intergenic
1039009784 8:33080373-33080395 ATTCCCCTGCAGACTTCAGAGGG + Intergenic
1044622996 8:94209089-94209111 TGTTTCTTGCAGACTTTGGAAGG - Intronic
1046690174 8:117275036-117275058 CATCCCCTGTAGACTTTGCAGGG - Intergenic
1046921263 8:119731918-119731940 CTTCCCTTTCAGACTGAGAAGGG - Exonic
1048936903 8:139365020-139365042 CTTCCCTCACTGCCTTTGGAAGG - Intergenic
1049038833 8:140097521-140097543 CTTGCCTTGTAGACTGTGGCAGG - Intronic
1049269271 8:141685566-141685588 CTTCTCTTGGAGCCTTTGAAGGG - Intergenic
1050611517 9:7358878-7358900 CTTCCCTTGCATAATTGGTAGGG + Intergenic
1050846708 9:10230193-10230215 CCTCCCTTGCAGTCCTTGGAAGG + Intronic
1053729673 9:41040456-41040478 TTCCCCTGGAAGACTTTGGAGGG - Intergenic
1054698834 9:68391606-68391628 TTCCCCTGGAAGACTTTGGAGGG + Exonic
1059985846 9:119819633-119819655 CTCTCCTTTCTGACTTTGGAAGG - Intergenic
1186709738 X:12181028-12181050 CTTCCTTCTCTGACTTTGGAAGG - Intronic
1187856627 X:23643101-23643123 CTTCTCTTGCAGCCCTTGGAAGG + Intergenic
1189343193 X:40220127-40220149 CCTCCCTTAGAGGCTTTGGAGGG - Intergenic
1189956835 X:46284105-46284127 CTTCCCTTGGAACCTTAGGAAGG - Intergenic
1191224672 X:58030889-58030911 CTGCCCTTGCTGCCTTTGGATGG - Intergenic
1193271209 X:79531532-79531554 CTTCCCTTCCACATTGTGGAGGG + Intergenic
1195911326 X:109891041-109891063 CTTCCCTTGCGTTCTTGGGAGGG - Intergenic
1197862386 X:130984662-130984684 CTTCCCCTGCAGGCTTTGCTGGG - Intergenic
1199819543 X:151431044-151431066 GTTCCCTTGCAGCCTTCTGAAGG + Intergenic
1199977246 X:152901566-152901588 CTTCACTTGTAGCCTTTGGATGG + Intergenic
1201639294 Y:16161590-16161612 CCTCCCTTGGAGCCTGTGGAGGG + Intergenic
1201663519 Y:16423737-16423759 CCTCCCTTGGAGCCTGTGGAGGG - Intergenic