ID: 1037391220

View in Genome Browser
Species Human (GRCh38)
Location 8:18393791-18393813
Sequence CCAAATCCTGAATTTTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 1, 2: 2, 3: 44, 4: 457}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037391220_1037391223 18 Left 1037391220 8:18393791-18393813 CCAGAAAAAAATTCAGGATTTGG 0: 1
1: 1
2: 2
3: 44
4: 457
Right 1037391223 8:18393832-18393854 ATAAAAACTGAAAAAACAATGGG No data
1037391220_1037391224 23 Left 1037391220 8:18393791-18393813 CCAGAAAAAAATTCAGGATTTGG 0: 1
1: 1
2: 2
3: 44
4: 457
Right 1037391224 8:18393837-18393859 AACTGAAAAAACAATGGGCAAGG No data
1037391220_1037391222 17 Left 1037391220 8:18393791-18393813 CCAGAAAAAAATTCAGGATTTGG 0: 1
1: 1
2: 2
3: 44
4: 457
Right 1037391222 8:18393831-18393853 AATAAAAACTGAAAAAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037391220 Original CRISPR CCAAATCCTGAATTTTTTTC TGG (reversed) Intronic
901973497 1:12926485-12926507 CCAACTCCTGAATACTATTCAGG - Intronic
902011682 1:13275282-13275304 CCAACTCCTGAATACTATTCAGG + Intergenic
903785133 1:25856040-25856062 CCAAATCCTGCCTTTTTCCCTGG - Intronic
904315830 1:29662301-29662323 CCAACTCCAGAATTTGTTTCTGG + Intergenic
905148261 1:35904983-35905005 CGCAACCCTCAATTTTTTTCTGG + Intronic
907626155 1:56032103-56032125 CTAAATCCTGAATTCTTGCCTGG + Intergenic
908328412 1:63045771-63045793 ATAGAACCTGAATTTTTTTCAGG - Intergenic
908531112 1:65035124-65035146 GAAAATCCTGAAGTATTTTCTGG - Intergenic
908711200 1:67017373-67017395 CTAAAACCTGAATTCTTTCCTGG + Intronic
909173256 1:72321881-72321903 CCAAATCCTGAATCTAATTTAGG + Intergenic
909443084 1:75719538-75719560 CTAAATCCTGAATTATTTCCTGG + Intergenic
910140471 1:84021768-84021790 CCAAATCCTTAAATTTTTCCTGG - Intergenic
910359957 1:86405675-86405697 AAACATCCTGGATTTTTTTCAGG - Intergenic
911021468 1:93392814-93392836 CCGAATCCTGAATTCTTTCCTGG - Intergenic
911895579 1:103429373-103429395 CCACATCCTGAATTATATTTAGG - Intergenic
912981521 1:114378282-114378304 CTAAATCCTGAATTCTTTCCAGG + Intergenic
913100653 1:115561210-115561232 TCAGATCATGAATTATTTTCTGG - Intergenic
913243601 1:116852064-116852086 CCAAAGCCTGCATTCTTTCCAGG - Intergenic
913488634 1:119357445-119357467 CCAGAACCTGATTTTTTTTCAGG - Intergenic
914961008 1:152207391-152207413 CCAAACCCTGACCCTTTTTCTGG - Intergenic
915821577 1:159030272-159030294 CCACCTTCTGAATTCTTTTCTGG + Intronic
916352942 1:163872727-163872749 CCTAATATTGAATTCTTTTCTGG + Intergenic
916651480 1:166838783-166838805 CCATACCCAGAATCTTTTTCTGG + Intergenic
916816859 1:168362582-168362604 CCAACTCCTGAAATTTTATCAGG - Intergenic
917022517 1:170604269-170604291 CCACATCCTAAATATTTTTGAGG + Intergenic
917084376 1:171291453-171291475 CCAAATCTTGATTTTTTTTACGG + Intergenic
919393355 1:197014830-197014852 CTAAATCCTGAATTATTTCCTGG + Intergenic
919814313 1:201428134-201428156 CCACACCCTGAATTCTCTTCTGG + Intronic
919868779 1:201804467-201804489 CCAAATCCCTATTTTTTTCCAGG + Exonic
919899860 1:202035822-202035844 TCAACTCCTGGATCTTTTTCTGG - Intergenic
919936253 1:202252610-202252632 CCACAACCTGAATTCTTGTCAGG - Intronic
920517258 1:206594731-206594753 TAAAATAGTGAATTTTTTTCTGG - Intronic
922383099 1:225053172-225053194 ACAAATCCTGAATTTGTGTGGGG - Intronic
922505939 1:226125675-226125697 CCAAATCCTGCATCTTCTGCAGG - Intergenic
923491122 1:234484930-234484952 CCAAATCCCAATTTTTTTGCGGG - Intergenic
924304060 1:242668778-242668800 CCAAGACCTGATTTTTTTTTGGG - Intergenic
924355166 1:243165576-243165598 GAATGTCCTGAATTTTTTTCTGG + Exonic
1063330089 10:5149149-5149171 CTGAATCCTAAATTATTTTCTGG - Intergenic
1064327700 10:14366144-14366166 CCAAATTCTTATTTTTTTTTAGG - Intronic
1067214474 10:44290866-44290888 CTAAATCCTGAATTCTTTCTTGG + Intergenic
1067676103 10:48378580-48378602 CTAAATCCTGAATTATTTCCTGG - Intronic
1067940806 10:50654080-50654102 CCAGATCCTCCATTTTTTTGTGG + Intergenic
1068043605 10:51858451-51858473 GAAAATCCTGAACTTTATTCAGG - Intronic
1068069598 10:52180299-52180321 TCAAATCATGAATTGTTTCCCGG + Intronic
1068431470 10:56937429-56937451 CTGAATCCTGAATTGTCTTCTGG - Intergenic
1068653195 10:59546160-59546182 CCAAATACTTAATTTTTTACTGG - Intergenic
1070088137 10:73256416-73256438 CCAACTGCTGCACTTTTTTCAGG - Exonic
1070420333 10:76229910-76229932 CCAACTCCTGAGATCTTTTCAGG + Intronic
1071055069 10:81500061-81500083 CGAAATCCTAAATTCTTTTCTGG - Intergenic
1071219127 10:83443220-83443242 CCAAATCCTGAATTGTTTTCTGG + Intergenic
1071389605 10:85158726-85158748 CTGAATCCTGAATTATTTCCTGG + Intergenic
1071455326 10:85845513-85845535 CAAAATCCCAAATTTTTTTGTGG + Intronic
1072412742 10:95218857-95218879 CCAGATTCTGAATGTTTTTGAGG - Intronic
1073791560 10:106945253-106945275 CCAGATCCTCCATATTTTTCAGG - Intronic
1074204440 10:111270530-111270552 CATCATCCTGAATTTTTTTAAGG - Intergenic
1074606303 10:114971434-114971456 TAAAATCTTGAGTTTTTTTCAGG + Intronic
1074717265 10:116231159-116231181 CCAATCCCTGCATCTTTTTCAGG - Intronic
1075928613 10:126273989-126274011 CCAAATCCTGTGTTCCTTTCTGG + Intronic
1076309575 10:129495113-129495135 CCAGATTGTGAATTTTTTTCAGG + Intronic
1077596394 11:3535410-3535432 CATTATTCTGAATTTTTTTCAGG - Intergenic
1078290404 11:10005159-10005181 CCAACTCCTGAGATTTTATCAGG - Intronic
1078834377 11:15013039-15013061 CTAAATCCTGAATTCTTTGTGGG - Intronic
1078988602 11:16621675-16621697 TCAACTGCAGAATTTTTTTCAGG + Intronic
1079530880 11:21451433-21451455 CCAAAACCTGGGTTTTTTCCTGG + Intronic
1079682802 11:23320081-23320103 CCAACTCCTGAAATCTTATCAGG - Intergenic
1079758365 11:24295928-24295950 GAAAATCCTGAATTTTCTTTAGG + Intergenic
1080048448 11:27834396-27834418 CAAAATGCTAAATTTTTATCAGG + Intergenic
1081366093 11:42237259-42237281 ACAAATACAGAATTTTTTTATGG + Intergenic
1083929062 11:65829331-65829353 CCATGTCCTGAACTTTTTTGGGG - Intronic
1084202911 11:67573953-67573975 CTAAATCTTGAATTATTTCCTGG + Intergenic
1085963413 11:81490960-81490982 CCAGATCCAGAACTCTTTTCTGG + Intergenic
1087490808 11:98824745-98824767 CTAAATCCTGAATTATTTCCTGG + Intergenic
1087522304 11:99255203-99255225 CCAAATCATTAACTCTTTTCTGG - Intronic
1090421318 11:126577275-126577297 CCTGATACTGAATTTGTTTCAGG - Intronic
1091363291 11:134995511-134995533 CTAAATCCTATTTTTTTTTCTGG - Intergenic
1092422564 12:8344179-8344201 CATTATTCTGAATTTTTTTCAGG - Intergenic
1093687514 12:22073384-22073406 CTAAATCCTGAATTCTTTCTGGG - Intronic
1094043034 12:26137315-26137337 AGAAATGCTGAATTTTTGTCTGG - Intronic
1094227667 12:28064315-28064337 CCAAAGCATTATTTTTTTTCAGG + Intergenic
1094430405 12:30362136-30362158 CTGAATCCTGAATTCTTTCCTGG - Intergenic
1095126124 12:38479447-38479469 AAAAATACTGAATATTTTTCAGG + Intergenic
1095164566 12:38956561-38956583 CCAAAACCTCACTTATTTTCTGG + Intergenic
1095479088 12:42615250-42615272 TTGAATTCTGAATTTTTTTCTGG - Intergenic
1095496216 12:42787114-42787136 TCAAATCTTGGGTTTTTTTCTGG + Intergenic
1095724987 12:45441849-45441871 CCAAAGCCTGTATTTCTTTAGGG - Intergenic
1096381553 12:51162670-51162692 CGAAATCCTGATTTTTTTTGTGG + Intronic
1096898125 12:54845674-54845696 CCAAATCATGAGTTGTTTTTGGG - Intronic
1099316021 12:81083334-81083356 CCAAAAGCTGAATTTTTTACAGG - Intronic
1100017616 12:90030338-90030360 CAAGATCCTGAATTGTTTTTAGG - Intergenic
1100147372 12:91694686-91694708 CAAAATCCTAAGTTTTTTGCAGG + Intergenic
1102136297 12:110579243-110579265 CCAACTCATGAAGTTATTTCAGG + Intronic
1102445271 12:112997522-112997544 GTAAATCCTTGATTTTTTTCTGG - Exonic
1102575302 12:113852521-113852543 CCAATTCCTGAATTTGCTTTCGG + Intronic
1102622103 12:114204276-114204298 CCAGATCCCGAATTTTTTGTAGG + Intergenic
1105745983 13:23377293-23377315 CTACATTGTGAATTTTTTTCAGG - Intronic
1107234976 13:38157420-38157442 CTGAATCCAGTATTTTTTTCAGG + Intergenic
1107296569 13:38915310-38915332 CCAAATGCTTAATTTTTCCCAGG - Intergenic
1107519238 13:41162828-41162850 CTGAATCCTGAATTATTTCCTGG + Intergenic
1108623202 13:52203889-52203911 CTAAATCCAGATTATTTTTCTGG + Intergenic
1108718446 13:53105437-53105459 CCAACTCCTGAAATCTTATCTGG + Intergenic
1108775026 13:53755436-53755458 TCAACACCAGAATTTTTTTCTGG + Intergenic
1108795460 13:54024495-54024517 CCATATCCTGAATTCTATTTCGG - Intergenic
1109170365 13:59088721-59088743 CCAAGGCCTCCATTTTTTTCTGG - Intergenic
1109408695 13:61936269-61936291 CCAACTCCTGAGATTTTATCAGG + Intergenic
1109462157 13:62675388-62675410 ACAAATTCTGAAGTTTTTTCTGG + Intergenic
1110819623 13:79899408-79899430 CAAGATCCTGCATTTTTTTCAGG + Intergenic
1112539725 13:100296789-100296811 CCAAATCCTGATTTTGATTATGG - Intronic
1113027241 13:105954621-105954643 CCAAATCCGGAATTGTTTCCTGG + Intergenic
1114875154 14:26707568-26707590 CTAAATTCTTATTTTTTTTCTGG + Intergenic
1114967950 14:27987262-27987284 CCAAATCTTAAATATTTATCTGG - Intergenic
1114990879 14:28287588-28287610 CCTATTGGTGAATTTTTTTCAGG + Intergenic
1116169797 14:41385591-41385613 AAAATGCCTGAATTTTTTTCTGG + Intergenic
1116173267 14:41430201-41430223 CCAAATCCTGAGATCTTATCTGG - Intergenic
1116217867 14:42043643-42043665 CCCCATCCTAGATTTTTTTCTGG - Intergenic
1116233113 14:42243165-42243187 CCCGATCCTGAATTCTTTCCTGG - Intergenic
1116423215 14:44757968-44757990 CCAGATGCTGAATTTTCTTTTGG - Intergenic
1118297071 14:64580133-64580155 CTAATTCTTTAATTTTTTTCTGG - Intronic
1118588867 14:67385294-67385316 CCAAATCTTGAATTTCTGCCAGG + Exonic
1119332036 14:73802198-73802220 CCTAATCCTGAAGTTCTTTCTGG + Intergenic
1119713949 14:76845025-76845047 CCAAATTCTGAATGTATTTTGGG - Intronic
1119831643 14:77708050-77708072 CCGGATCCGGAAATTTTTTCCGG + Exonic
1119986392 14:79142822-79142844 GCAAATCCACAATATTTTTCTGG - Intronic
1120710788 14:87790978-87791000 CCAAACCCTGAATCTTATCCTGG - Intergenic
1120726826 14:87952592-87952614 ATAAAAGCTGAATTTTTTTCCGG - Intronic
1121622071 14:95357219-95357241 CAACATCCTGAATTTGTTTAGGG + Intergenic
1202842272 14_GL000009v2_random:132801-132823 CTGAATCCTGAATTATTTCCTGG - Intergenic
1202911659 14_GL000194v1_random:123036-123058 CTGAATCCTGAATTATTTCCTGG - Intergenic
1202880959 14_KI270722v1_random:59594-59616 CTGAATCCTGAATTATTTCCTGG + Intergenic
1124617053 15:31249386-31249408 CCAAATCATCAAGTTTTTCCTGG - Intergenic
1125023368 15:35006609-35006631 CCAAATTCATAATTTTTTTCAGG - Intergenic
1125106449 15:35977092-35977114 GGATATCCTGTATTTTTTTCTGG - Intergenic
1125115476 15:36086398-36086420 CCAAATCCTGAGATTTTATGGGG - Intergenic
1125286903 15:38102908-38102930 CCAATTCCTGAGTTTTTCTTAGG + Intergenic
1126075403 15:44904269-44904291 CCAAATCCTGTCCTTCTTTCAGG - Intergenic
1126082968 15:44983518-44983540 CCAAATCCTGTCCTTCTTTCAGG + Intergenic
1126310270 15:47308003-47308025 CCAAATTCTGAAATTTTTGCAGG - Intronic
1126328140 15:47504239-47504261 CCAACTTCTGAATTCTTCTCTGG + Intronic
1126615473 15:50574614-50574636 GTAAATCTTTAATTTTTTTCTGG - Intronic
1127716286 15:61652295-61652317 CTAAATCCTGAATTCTTTCTGGG - Intergenic
1128085549 15:64883994-64884016 CCAGAACCTGAATTCTGTTCCGG + Intronic
1128184051 15:65629325-65629347 CTAAGTCCTTTATTTTTTTCTGG - Intronic
1130572736 15:85062929-85062951 CCAAAGCCAGAATTTTTATGAGG - Intronic
1131414040 15:92236521-92236543 CCAAATCCTAAATTCTTTATTGG + Intergenic
1134125112 16:11611053-11611075 CCATGTACTGTATTTTTTTCTGG - Intronic
1134826262 16:17286901-17286923 TCAAACCCTGAATTCTGTTCAGG + Intronic
1135171385 16:20187028-20187050 CCAAATCCTGAAGGTTATTTTGG + Intergenic
1135410721 16:22232390-22232412 CCAACTTCTTAATTTTTTTTTGG + Intronic
1135586417 16:23675133-23675155 CCAATTTCTGAATGTCTTTCTGG + Exonic
1136411661 16:30081189-30081211 CCAATTCCTGACCTTTTTTGGGG - Intronic
1137917206 16:52445203-52445225 ACAAATCATGAACTTATTTCAGG - Intronic
1139120705 16:64012931-64012953 GCAAATCATGAATTTGTCTCAGG - Intergenic
1139841050 16:69880971-69880993 CCAATTCCTGATCTTTTTTTTGG + Intronic
1140162301 16:72510124-72510146 CAAAATGCTAAATTTTTTTAAGG + Intergenic
1140433715 16:74927163-74927185 CTAAATCATTAATTTTTTTTTGG - Intronic
1140548397 16:75835307-75835329 CCAAAATCTGCATTTGTTTCTGG + Intergenic
1141723932 16:85773707-85773729 CCAAATCCTGCATTTTTAGCAGG - Intronic
1141930771 16:87201246-87201268 CCAAAGCCTGTACATTTTTCAGG + Intronic
1143891922 17:10108527-10108549 CCAAAATCTGAAACTTTTTCAGG - Intronic
1143939264 17:10522275-10522297 AAAAATCATCAATTTTTTTCAGG + Intronic
1143986258 17:10917104-10917126 GCTGATCCTGAATTGTTTTCTGG + Intergenic
1144129348 17:12230875-12230897 AAAAAGTCTGAATTTTTTTCTGG - Intergenic
1144471992 17:15552091-15552113 CCAAATTCTTAAAATTTTTCTGG - Intronic
1144852515 17:18251177-18251199 CCAACTCCAGAGTTTTGTTCAGG - Intronic
1145284272 17:21493277-21493299 CTGAATCCTGAATTCTTTTCTGG + Intergenic
1145393182 17:22472215-22472237 CTGAATTCTGAATTCTTTTCTGG - Intergenic
1146088541 17:29852864-29852886 CTAATTCCTGAATTGTTTCCGGG + Intronic
1146232160 17:31121848-31121870 ACAGATGCTGAATTTTTTTCTGG + Intronic
1146974117 17:37096460-37096482 CCAAATCCAGCCTTTTCTTCTGG + Intronic
1147700253 17:42389004-42389026 CCAACTCCTGAATTGGGTTCTGG + Intergenic
1150729730 17:67681882-67681904 CCACTTCCAGAATTTTATTCTGG + Intronic
1153154177 18:2130101-2130123 TCAATTCCTGAATATTTCTCAGG + Intergenic
1153611180 18:6886905-6886927 CCAAATCCAGAATTATTCTGAGG + Intronic
1153885675 18:9463427-9463449 CCAAATCCTAAATGCTTTCCAGG - Intergenic
1154040716 18:10853002-10853024 CCAACTCCTGAAGTCTTATCGGG - Intronic
1154108019 18:11541044-11541066 CTAAATCCTGAATTTTTTGTGGG + Intergenic
1155323174 18:24639066-24639088 CCAAATACTGAACTTTTTACTGG - Intergenic
1156442147 18:37201376-37201398 CTGAATCCTGAATTATTTCCTGG - Intronic
1156513887 18:37663626-37663648 CCAAATCCTGGCTTTTAATCAGG - Intergenic
1157336169 18:46739141-46739163 CCAAATCCTGCTTCTCTTTCTGG - Intronic
1158315019 18:56202645-56202667 GCTAATCCTGATTTTTTTTGTGG - Intergenic
1159243606 18:65776246-65776268 CCAAATCCTGGAAGTGTTTCTGG - Intronic
1160883436 19:1333367-1333389 ACAAATCCTTTTTTTTTTTCAGG - Intergenic
1164836860 19:31360848-31360870 CCAAATCCAGAATTATTTAATGG + Intergenic
1165088679 19:33370456-33370478 CCAAATCCTGTCAATTTTTCAGG + Intergenic
1166273775 19:41736463-41736485 CTGAATCCTGAATTCTTTCCTGG - Intronic
1166429015 19:42707765-42707787 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166442666 19:42829130-42829152 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166450463 19:42895584-42895606 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166462356 19:42999900-42999922 CTGAATCCTAAATTTTTTCCTGG + Intronic
1166479633 19:43159846-43159868 CTGAATCCTAAATTTTTTCCTGG + Intronic
1167423736 19:49418718-49418740 CCCAATCATGTATTCTTTTCGGG - Intergenic
1167672987 19:50866096-50866118 CTAAATCCTGAATTATTTTCTGG + Intronic
1202656564 1_KI270708v1_random:28699-28721 CTGAATCCTGAATTATTTCCTGG + Intergenic
925533544 2:4891467-4891489 CAAAATCCTGGACTTTTATCTGG + Intergenic
926265509 2:11315595-11315617 ACATATCCATAATTTTTTTCTGG + Intronic
926865457 2:17352524-17352546 CCAAATTCTCATTTTTTTCCTGG + Intergenic
927327682 2:21824709-21824731 AGAAAACCAGAATTTTTTTCTGG + Intergenic
927968525 2:27288092-27288114 CCAAAACCTGGATTCTTCTCAGG + Intronic
928334936 2:30389890-30389912 CCAACTCCTGAATGTACTTCAGG - Intergenic
929161176 2:38833525-38833547 CTAAATCCTTTATTTTCTTCAGG - Intronic
929553625 2:42909973-42909995 CAAAATCCTGAATTTGTTTGGGG - Intergenic
930113856 2:47701982-47702004 CCAAACCCTGCCTTCTTTTCTGG - Intronic
930461376 2:51682310-51682332 CCTAATCCTTACTCTTTTTCTGG + Intergenic
930898660 2:56476714-56476736 CCAATTCCTGAAATCTTATCAGG - Intergenic
931104543 2:59040940-59040962 CAAAAGCCTGCATTATTTTCTGG + Intergenic
931210171 2:60186154-60186176 CCATATCCTTACTTGTTTTCTGG - Intergenic
931421621 2:62133286-62133308 CCAACTCCTGAATGTTCTTTTGG + Intronic
931429751 2:62198609-62198631 AAAAATTATGAATTTTTTTCTGG + Intronic
931537378 2:63293696-63293718 CCAGCTCCAGAATTTCTTTCTGG - Intronic
931763941 2:65438218-65438240 CTAAGTCTTTAATTTTTTTCAGG - Intergenic
931834747 2:66086452-66086474 CAACCTTCTGAATTTTTTTCTGG - Intergenic
933189959 2:79323570-79323592 ACAGATCCACAATTTTTTTCTGG + Intronic
933274622 2:80270265-80270287 CTAAATCCTCTATTTTTTTAGGG + Intronic
936065794 2:109331272-109331294 CCAATTCCTGAATCTTGCTCTGG - Intronic
936493108 2:112992716-112992738 CCAAATTTTGAATTGTTTTTTGG + Intergenic
936660543 2:114538092-114538114 ACAAATCCTTAATTTATCTCTGG - Intronic
936712082 2:115143033-115143055 CCAAATGCTGGATTTTTTCTAGG - Intronic
936973404 2:118196034-118196056 CCAAGTCCAGGATTTGTTTCTGG - Intergenic
937514872 2:122641779-122641801 CCAAATCTTCATGTTTTTTCAGG - Intergenic
937787300 2:125916991-125917013 GCAGAGCCTGAATCTTTTTCTGG + Intergenic
939132290 2:138250547-138250569 ACAAACCCTGGATTTTTTTCAGG + Intergenic
939160482 2:138582940-138582962 CCAATTCCTGAATATTTTATTGG + Intergenic
941540200 2:166772520-166772542 CTAAATCCTCAATTCTTTTCTGG + Intergenic
941582960 2:167322100-167322122 CCAGATCCTAAATTTCTTTGAGG - Intergenic
941891721 2:170589131-170589153 CTAAACCCTGAATTTTCTTGGGG - Intronic
943871528 2:193007196-193007218 CCAGCTTCTTAATTTTTTTCTGG - Intergenic
944016396 2:195044563-195044585 CCAAACCTTGTATTTATTTCTGG + Intergenic
944209279 2:197189548-197189570 CGAAACCCTGAATTTGTGTCTGG - Intronic
944364685 2:198904034-198904056 CCAAAGCCTGAATTTCATTTAGG + Intergenic
944954612 2:204793941-204793963 ACAAATCATAACTTTTTTTCTGG + Intronic
945319383 2:208404303-208404325 CCAACTTCTTAATTTTCTTCAGG + Intronic
945500142 2:210562568-210562590 CTAAAGCCAGAATTTATTTCAGG - Intronic
945803533 2:214462925-214462947 TCAAATACTGAATATTTTGCAGG + Intronic
946377167 2:219318475-219318497 CCAACGCCTGTATTTTTTTTGGG + Intergenic
946572442 2:221039779-221039801 CCAAAGCCTGACTGTGTTTCAGG - Intergenic
946752077 2:222902618-222902640 CCACATGCCTAATTTTTTTCTGG - Intronic
1168870463 20:1123183-1123205 CGACATCCTGAATTTTATTTGGG + Intronic
1169804809 20:9548508-9548530 CTCAATCCTGAACTGTTTTCTGG + Intronic
1169993421 20:11528973-11528995 CTAAATTCTGAATATTTTTATGG - Intergenic
1170173443 20:13441005-13441027 CCAAATCCAGAAACTTCTTCTGG + Intronic
1170497417 20:16939755-16939777 CCAACTCCTGAGTTCTTATCAGG - Intergenic
1171059404 20:21941769-21941791 CCAAATCCTGAAATTTTTGAAGG - Intergenic
1174221253 20:48957317-48957339 ACAGATCCTGAATTTTGTTTTGG - Intronic
1174930487 20:54808596-54808618 CAGAATCCTGATTTTTGTTCAGG + Intergenic
1175019431 20:55828645-55828667 TGAAATTCTGAATTTTTTTAAGG + Intergenic
1175353006 20:58339536-58339558 CCAATTTATGAATTTATTTCAGG + Intronic
1175480592 20:59308030-59308052 ACAAGTCCTAAATTTTATTCTGG + Intronic
1175584221 20:60125060-60125082 CAATATACAGAATTTTTTTCTGG - Intergenic
1176631020 21:9137703-9137725 CTGAATCCTGAATTATTTCCTGG - Intergenic
1176642270 21:9317117-9317139 CTGAATCCTGAATTATTTCCTGG + Intergenic
1176918994 21:14663822-14663844 GTACATCCTGAATTTTTTTCTGG + Intergenic
1177082539 21:16658356-16658378 CAAAATCCTTAAGTTTTTTATGG + Intergenic
1177361817 21:20082955-20082977 CCAAAATATGAATTTTATTCTGG - Intergenic
1177380785 21:20341339-20341361 CAAACTCCTGAATTTTTATGTGG - Intergenic
1178697981 21:34810472-34810494 CCAAATCCTGAAAATGTTTGGGG - Intronic
1180351280 22:11806469-11806491 CTGAATCCTGAATTATTTCCTGG + Intergenic
1180375571 22:12089898-12089920 CTGAATCCTGAATTATTTCCTGG + Intergenic
1180386921 22:12185606-12185628 CTGAATCCTGAATTATTTCCTGG - Intergenic
1182577143 22:31280668-31280690 CCAGATCATCAGTTTTTTTCGGG - Intergenic
949320127 3:2800317-2800339 TCAAAATCTTAATTTTTTTCGGG + Intronic
949431323 3:3979155-3979177 CCAAATTGTGATTTTTTTTGTGG - Intronic
949650421 3:6152094-6152116 GCAAATGCTGAATATTTTTGTGG + Intergenic
951539965 3:23773052-23773074 CAAAATGATGACTTTTTTTCTGG - Intergenic
952069112 3:29611561-29611583 TCAATACCTGCATTTTTTTCTGG - Intronic
952667355 3:35922728-35922750 CAAAATCCTGAATTTCTGCCTGG + Intergenic
953642691 3:44724518-44724540 CTTGATCCTGAATTTTTCTCAGG + Intergenic
955338938 3:58109873-58109895 CCAAATCCTTACTCTTTCTCAGG + Intronic
955825282 3:62939663-62939685 CCAACTCCTGAGATTTTATCAGG - Intergenic
956127562 3:66025376-66025398 CCAAATAATTAATTTTTTTTTGG - Intronic
956683675 3:71804818-71804840 CCAAACCCTTATTTTTTTTAAGG + Intergenic
956814229 3:72893369-72893391 CTAACTCCTCCATTTTTTTCAGG + Intronic
957097846 3:75793531-75793553 CTGAATCCTGAATTATTTCCTGG - Intergenic
957293344 3:78306080-78306102 CCACATCTTGAATGTTTTGCTGG - Intergenic
957315874 3:78575807-78575829 CCAAATCCTGAAATCTTATTGGG + Intergenic
959294766 3:104521567-104521589 CCAAATCCTGACATCTTGTCAGG + Intergenic
959365853 3:105456491-105456513 ACAAACTATGAATTTTTTTCTGG - Intronic
960453548 3:117841360-117841382 CCAAATTCTCATTCTTTTTCAGG + Intergenic
961068705 3:123899788-123899810 CAAACTCCTGATCTTTTTTCTGG + Intronic
961497264 3:127303929-127303951 CCAAATACCCAATTTCTTTCAGG + Intergenic
961978880 3:131055572-131055594 CCACATCCTGATTTTGTTTTTGG - Intronic
964313486 3:155419032-155419054 CCAAATCCTGGCTTCTTTACTGG - Intronic
964605322 3:158554592-158554614 CCAAATCATCAATTTAATTCTGG + Intergenic
964623282 3:158735895-158735917 CAAAATCCTGAGTTTTATTTTGG - Intronic
964954884 3:162341404-162341426 CCAATTCCTTCATTTTTTTATGG - Intergenic
965384235 3:168026727-168026749 CCTAGTCCTGAAATATTTTCAGG - Intronic
965746505 3:171932063-171932085 CACAATCCTGAATTTTGTGCTGG - Intronic
966221362 3:177554589-177554611 CAAAATACTGAATTGCTTTCGGG + Intergenic
967043171 3:185712750-185712772 ACAAATCTTGAATTTTGTTTGGG + Intronic
968248821 3:197185597-197185619 ACAAAACTTGAATTTTTTTCTGG - Intronic
1202744619 3_GL000221v1_random:87901-87923 CTGAATCCTGAATTATTTCCTGG - Intergenic
969199639 4:5592622-5592644 CCAACTCCTGAGTTCTTATCGGG - Intronic
969305086 4:6321667-6321689 CCAAATCCAAACTTTTTTTTTGG - Exonic
969743098 4:9048045-9048067 CATTATTCTGAATTTTTTTCAGG + Intergenic
969802482 4:9580126-9580148 CATTATTCTGAATTTTTTTCAGG + Intergenic
970073178 4:12186403-12186425 CAAAAATCTGATTTTTTTTCTGG + Intergenic
971403543 4:26299105-26299127 CCAACTCCTTTATTTTTTTGAGG - Intronic
971851310 4:31989244-31989266 CCAACTCCTGAGATTTTATCAGG - Intergenic
972912166 4:43830953-43830975 CCAACTCCTGAAATCTTATCGGG - Intergenic
973618284 4:52702491-52702513 CTAAATCCTAAATTATTTCCTGG + Intergenic
973678284 4:53287842-53287864 TCAGATCATGAATTATTTTCTGG - Intronic
973901461 4:55477479-55477501 AAAAATCCTAAAATTTTTTCAGG + Intronic
974326653 4:60422986-60423008 CCAAATCCTGAGATCTTATCAGG - Intergenic
974840047 4:67288959-67288981 CCAAATCCTGAAATCTTATTGGG - Intergenic
974934329 4:68395249-68395271 CCAACTCCTGAAATCTTATCAGG - Intergenic
974981457 4:68962488-68962510 CTTAATCCTGAATTTTTTCTTGG + Intergenic
975056155 4:69932467-69932489 AAAAATCAAGAATTTTTTTCAGG + Intronic
975335002 4:73165850-73165872 CAAGATCCTGATTTTTTTTATGG - Intronic
976147873 4:82060482-82060504 CCAAATCCCGTATCTTTATCAGG + Intergenic
977412875 4:96690211-96690233 ACAGATCCTAAATTTTGTTCAGG - Intergenic
977911484 4:102542152-102542174 TCAAATCCTGCATTTTCTACTGG + Intronic
978107609 4:104923104-104923126 TCAAATCCTGATTATTTTTATGG - Intergenic
978110871 4:104962907-104962929 TCATATCCTGATTTTTTTCCTGG + Intergenic
978134171 4:105236487-105236509 ACACATCCTGAACTTTTTGCAGG + Exonic
978355216 4:107865269-107865291 CCAGATTGTGTATTTTTTTCTGG - Intronic
979187050 4:117810084-117810106 CTAAATCCTAAATTCTTTCCTGG + Intergenic
979187983 4:117822788-117822810 CCAAATTCTAACTTTTATTCAGG + Intergenic
979397287 4:120203670-120203692 CCAACTCCTGAGATCTTTTCAGG + Intergenic
981763848 4:148224892-148224914 CCAACTCCAGGAGTTTTTTCTGG - Intronic
982581868 4:157188809-157188831 CAAAATTTTGAATTTTTTTGGGG - Intergenic
982947282 4:161640480-161640502 TCAGCTCCAGAATTTTTTTCTGG - Intronic
983247441 4:165304196-165304218 CCAACTACATAATTTTTTTCAGG - Intronic
983400657 4:167261620-167261642 CTAAATGCTGAATTATTTTATGG + Intergenic
983403650 4:167297375-167297397 CCAAAGCTTAAATTTTTCTCAGG + Intergenic
983494818 4:168430585-168430607 GATAATCCTGAATCTTTTTCAGG + Exonic
983501871 4:168508622-168508644 ACAAAAACTGAATTTCTTTCAGG + Intronic
983660380 4:170125759-170125781 TCACATCTTGAATGTTTTTCTGG - Intergenic
983910966 4:173238749-173238771 CCAAAGCATGAATTTTTATAAGG + Intronic
984463778 4:180071203-180071225 CCATATCCTGAATCTTTTAATGG - Intergenic
984767720 4:183412407-183412429 ACAAATTCTGAATTTTGTACAGG + Intergenic
984918556 4:184744281-184744303 CCAAATCCTGAGATCTTATCCGG - Intergenic
984958654 4:185071949-185071971 CCTGATCCTAAATCTTTTTCTGG + Intergenic
1202757170 4_GL000008v2_random:75340-75362 CTGAATCCTGAATTATTTCCTGG + Intergenic
986024108 5:3834007-3834029 CCAAATTTTGAATTTTTAACAGG - Intergenic
986468123 5:8047430-8047452 CCAAAGCCTGAAGTTGTTTATGG - Intergenic
986685676 5:10273566-10273588 CCAAATCCTGAGATCTTATCAGG + Intergenic
986901975 5:12446713-12446735 CCAAATTATGAATTTTTTCCTGG - Intergenic
987489359 5:18556919-18556941 CCAAATTCTGAATTATTTCCTGG + Intergenic
988177514 5:27745346-27745368 TCAAATACTGGATTTTTTTCTGG - Intergenic
988698467 5:33648383-33648405 TCAAATCCTGAATTATTATTTGG + Intronic
988715072 5:33817616-33817638 CCACATCCTGGATTATTTTGTGG + Intronic
989639782 5:43572061-43572083 CTAAATCTTGAATTCTTTCCTGG - Intergenic
990759034 5:59108284-59108306 CCTAATCCTAAATTTTGTTTAGG + Intronic
990863040 5:60349749-60349771 CTAAATCCTAAATCTTTTTGAGG + Intronic
990899631 5:60736842-60736864 TAACCTCCTGAATTTTTTTCAGG + Intergenic
990911732 5:60859288-60859310 ACCTATCCTGTATTTTTTTCTGG + Intergenic
991210509 5:64099036-64099058 TCCAATCTTGACTTTTTTTCTGG + Intergenic
991241005 5:64459624-64459646 TAAAATCATGAATTGTTTTCTGG - Intergenic
991606112 5:68402827-68402849 GCAAATATTGAATTTGTTTCAGG + Intergenic
992132043 5:73703268-73703290 CCAAATCTAGATTTTTTTTCAGG + Intronic
992623691 5:78617904-78617926 CCAGCCCCTGAATTTTTTTAAGG - Intronic
993451497 5:88076386-88076408 TCAGATCCTGAGCTTTTTTCTGG - Intergenic
993454284 5:88109625-88109647 CCCATTCCTGAATATTGTTCTGG - Intergenic
994830332 5:104773930-104773952 CCAATTCCTGAATTTCTATTAGG - Intergenic
995083186 5:108077759-108077781 CTGAATCCTGAATTGTTTCCTGG + Intronic
995342733 5:111077667-111077689 CCTAATCCTCAATTCTTTTAGGG - Intronic
996482506 5:123990869-123990891 CCAAACCCTGCTTTTTTTTTAGG - Intergenic
997904962 5:137807419-137807441 CCAACTTCTGTATTTTTTTAGGG - Intergenic
999465936 5:151804496-151804518 TCAAATCCTGTATTTCTTACAGG - Exonic
999703960 5:154254576-154254598 TCAAATCAGGAATTTTTTACTGG + Intronic
999977878 5:156929842-156929864 CCACTTCCTGACTTTTTTTTAGG - Intronic
1002287151 5:178171401-178171423 CTAAATCCTGAATTCTTCCCAGG - Intergenic
1002907459 6:1462239-1462261 CTAAATCCTGAATCCTTTCCTGG + Intergenic
1003044182 6:2717736-2717758 CTAAATCCTGAACTATTATCAGG - Intronic
1003083356 6:3040524-3040546 CTAAATCCTGAATTCTTTCTGGG + Intergenic
1004586623 6:17008276-17008298 GTAAATACTGAATTTGTTTCTGG - Intergenic
1004643787 6:17540184-17540206 CAAAATTCTAAATTTTTCTCTGG + Intronic
1007847229 6:44769398-44769420 CCAACTCCTGAAATCTTATCAGG + Intergenic
1008002835 6:46378468-46378490 GTAAATCCTGAATTTCTCTCTGG - Intronic
1008099777 6:47378190-47378212 CCAAATCATGACTGTTTTCCTGG - Intergenic
1009589235 6:65644086-65644108 CAACCTTCTGAATTTTTTTCTGG - Intronic
1009657863 6:66569111-66569133 CCAAGTCCTGAATTCTTTCTCGG - Intergenic
1010339735 6:74734781-74734803 TCAAATCCTGAAATTTTCTTGGG - Intergenic
1010387075 6:75292947-75292969 CCACACCATGAATTTTTTTATGG + Intronic
1010715085 6:79219837-79219859 TCAAATGCTAAATTTTTATCAGG + Intronic
1010824012 6:80451054-80451076 GCTAATCCTGAATTATTTCCTGG - Intergenic
1010913759 6:81590287-81590309 CCAACTCCTGAAATCTTATCGGG - Intronic
1011028051 6:82891090-82891112 ACAAAATCTGAATCTTTTTCTGG - Intergenic
1011041769 6:83037178-83037200 CCAAATTCTGACTTGTTTTGGGG + Intronic
1011285906 6:85722529-85722551 CCAAATTCTAAAGTTTTTCCTGG - Intergenic
1011435801 6:87335340-87335362 CCAAATCCTGAAGTTGCTACAGG + Intronic
1011440538 6:87382384-87382406 AATAATTCTGAATTTTTTTCTGG - Intronic
1011594892 6:89006856-89006878 CAAAATTCTGAATTCTTTCCTGG + Intergenic
1012622373 6:101361684-101361706 CCATATTCTGACTTTTTTACTGG + Intergenic
1013020973 6:106217786-106217808 CAAAATTTTGAATTTTTTTGTGG - Intronic
1013044391 6:106470023-106470045 CCAAGTCCTGACTTTTCCTCGGG + Intergenic
1013633111 6:112004109-112004131 ATAAAAACTGAATTTTTTTCTGG + Intergenic
1013825521 6:114206006-114206028 CTAATTCCTGCATTTATTTCTGG + Intronic
1014301501 6:119687813-119687835 TCAAATACTGAAATTTTTTGGGG - Intergenic
1014718068 6:124888549-124888571 CCAATTCCAGAATTTCTATCTGG + Intergenic
1015067555 6:129049863-129049885 CAAAATCCTAACTTTGTTTCTGG + Intronic
1015087149 6:129309374-129309396 CCAAATCAGGAAGTTTATTCAGG - Intronic
1015903967 6:138097186-138097208 TCAAATCCTGATTCTTTTTTAGG - Intronic
1016104491 6:140145616-140145638 CCATGTCCTGAATTCTTTTTTGG - Intergenic
1017116673 6:150983934-150983956 CCAATTGTTCAATTTTTTTCTGG + Intronic
1017264014 6:152421598-152421620 CTGAATCCTGAATTGTTTCCTGG + Intronic
1018168641 6:161126276-161126298 CGACCTTCTGAATTTTTTTCTGG + Intergenic
1018408461 6:163514422-163514444 AGAAATCCTAACTTTTTTTCTGG + Intronic
1018664830 6:166125996-166126018 CCAAGTCCTGAGATCTTTTCGGG + Intergenic
1018832330 6:167452743-167452765 CCAGATCCTGAAATATTTTCTGG + Intergenic
1018884944 6:167927462-167927484 CTAAATCCTGCATTTCTTTGTGG - Intronic
1021185322 7:17557394-17557416 ACAAATCCTGAACTTTTTGCAGG + Intergenic
1021383863 7:20003724-20003746 TCTGATCCTGAATTTATTTCCGG + Intergenic
1021545307 7:21806669-21806691 CAAATTGCTGATTTTTTTTCAGG + Intronic
1021738950 7:23666082-23666104 CCAAACCCTGAATATTTTGAAGG - Intergenic
1024619078 7:51142007-51142029 CCAAATCCTGAGCTGTCTTCTGG + Intronic
1024673840 7:51620697-51620719 CTAAGTCCTGTTTTTTTTTCAGG - Intergenic
1025080417 7:55977088-55977110 ACAAATCTTGATTTTTTTTTTGG + Intronic
1026076710 7:67178167-67178189 CCACCTCCTGTTTTTTTTTCTGG - Intronic
1027566273 7:79799098-79799120 CCAAAATCTTAATTTGTTTCAGG + Intergenic
1028701280 7:93783467-93783489 CCAATTCTTGAATTTTTATTTGG + Intronic
1029070255 7:97889857-97889879 CATTATTCTGAATTTTTTTCAGG - Intergenic
1029245568 7:99197645-99197667 CCAATTCCAGAATTTGTATCTGG - Intronic
1030296196 7:107930459-107930481 CAGAATACTGATTTTTTTTCAGG + Intronic
1030661619 7:112224842-112224864 CCCAGCCCTAAATTTTTTTCAGG - Intronic
1030823087 7:114119547-114119569 CCAAATTTTTAATTTTTTTTAGG - Intronic
1030887181 7:114952479-114952501 CCAAAAGCTGGATTTTTTCCAGG + Intronic
1031083415 7:117279621-117279643 CCAGATCCTGGACTATTTTCTGG + Intronic
1031751308 7:125578419-125578441 CCTAATCCTCATTATTTTTCCGG - Intergenic
1032429443 7:131849019-131849041 TCAATTCCTGAATTGCTTTCAGG + Intergenic
1032444089 7:131965706-131965728 CCAAATCATGGAGTTTTATCAGG - Intergenic
1033678699 7:143570518-143570540 AAAAATTTTGAATTTTTTTCTGG - Intergenic
1033693139 7:143758932-143758954 AAAAATTTTGAATTTTTTTCTGG + Intergenic
1033832365 7:145269828-145269850 CCAATCCCTGAGTCTTTTTCCGG - Intergenic
1034719450 7:153276076-153276098 TCAAATACTGAATTTTTATTTGG - Intergenic
1034784536 7:153913588-153913610 TCAAATACTGAATATTTATCAGG - Intronic
1034866435 7:154646350-154646372 CCAAACCCGGAATGTGTTTCTGG + Intronic
1036252507 8:7174530-7174552 CATTATTCTGAATTTTTTTCAGG - Intergenic
1036364990 8:8112932-8112954 CATTATTCTGAATTTTTTTCAGG + Intergenic
1036539160 8:9686866-9686888 CCAAATTCTTCATTTTTTTTAGG - Intronic
1036885940 8:12553135-12553157 CATCATTCTGAATTTTTTTCAGG - Intergenic
1037130261 8:15400001-15400023 GCAAATCCTGCATTTGCTTCTGG - Intergenic
1037391220 8:18393791-18393813 CCAAATCCTGAATTTTTTTCTGG - Intronic
1037508576 8:19557618-19557640 CCTATTCCTGTATTTTATTCAGG + Intronic
1037646793 8:20799609-20799631 CCAAATCCAGAGATTTTCTCAGG - Intergenic
1038771234 8:30482687-30482709 CCAAACCCAGACTTCTTTTCAGG + Intronic
1039009352 8:33075682-33075704 CTAAGTCCTGTATTTTCTTCTGG + Intergenic
1039973551 8:42340502-42340524 TCAGATTTTGAATTTTTTTCAGG - Intronic
1040973838 8:53168277-53168299 AAAAACCCTGAATTTATTTCAGG - Intergenic
1041351044 8:56947831-56947853 CCAACTCCTGAGATTTTATCAGG - Intergenic
1041565107 8:59268318-59268340 CCTAATCCTAATTCTTTTTCCGG + Intergenic
1041730767 8:61060472-61060494 CAAATTTCTGCATTTTTTTCAGG - Intronic
1041831774 8:62162679-62162701 ACATATTTTGAATTTTTTTCAGG - Intergenic
1041915300 8:63132929-63132951 CCAAATTCTGAATTATTTCCTGG - Intergenic
1042374577 8:68035133-68035155 TCAAATCCTGAGTCTTTTTTGGG + Intronic
1043279846 8:78449718-78449740 CCATATCTTGTTTTTTTTTCAGG - Intergenic
1043985322 8:86688361-86688383 CATAAGCCTTAATTTTTTTCAGG + Intronic
1044198632 8:89408506-89408528 CTGAATCCTGAATTTTTTCTGGG + Intergenic
1044368195 8:91376115-91376137 TCAAATCCTGAATTGTTTTCTGG + Intronic
1045897055 8:107232199-107232221 CCAACTTATCAATTTTTTTCTGG + Intergenic
1046279372 8:112005469-112005491 CTAAATCCTAAATCATTTTCTGG - Intergenic
1046290019 8:112146522-112146544 TCAAACTCTAAATTTTTTTCTGG + Intergenic
1046326170 8:112649808-112649830 ACAAATGCTGCATTTTTTTCAGG + Intronic
1046988591 8:120421537-120421559 TCAAATCCTAAGTTTTTGTCTGG - Intronic
1047002355 8:120585727-120585749 GCAAATCCTGTTTTTTTTGCTGG + Intronic
1048562362 8:135554813-135554835 AAATATCCTGAATTTCTTTCAGG + Intronic
1050310510 9:4348231-4348253 CCTATTTCTGAATTTCTTTCAGG - Intronic
1051840121 9:21386721-21386743 TCAGATCCTGAGTTCTTTTCTGG + Intergenic
1052111045 9:24582064-24582086 CTAAATCATGAATTTTTACCTGG - Intergenic
1052621264 9:30912978-30913000 CGAAAGCCTGGATTTTTCTCAGG + Intergenic
1054444838 9:65304586-65304608 CAAAATGCTGATTTTTTTCCAGG + Intergenic
1055558531 9:77499971-77499993 CCAAATCCTAAATATTTAACAGG - Intronic
1055840215 9:80494319-80494341 CCAAATCCTGCATTTCTGTTTGG + Intergenic
1056259659 9:84835127-84835149 CCAAATCCAGACGTTTTATCTGG + Intronic
1056327923 9:85496061-85496083 CCCAATCCTGATTTCTTTGCAGG - Intergenic
1056377711 9:86030657-86030679 CCAATTCATGTCTTTTTTTCTGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057416721 9:94870326-94870348 TCAAAACATGAATTTTTTTAAGG + Intronic
1057599877 9:96449019-96449041 CCAGAGCCTGTATTTTGTTCAGG - Intergenic
1057789784 9:98117113-98117135 CTAAATCCTGAATTATTTCCTGG + Intronic
1058133036 9:101275002-101275024 CCAAATCATGACTCTCTTTCTGG + Intronic
1058143140 9:101379701-101379723 CTAAATCCTAAATTATTTTGTGG + Intronic
1058679296 9:107427135-107427157 CCAAATCCTACACTTTTCTCAGG - Intergenic
1059058936 9:111014729-111014751 CCAAATCTGGAGTTCTTTTCTGG + Intronic
1059128245 9:111715852-111715874 ATAAATACTGAATTTATTTCTGG + Intronic
1059292645 9:113240745-113240767 CAAAATGCTGAATTTTATTGAGG + Intronic
1059492546 9:114681007-114681029 ACAAAAACTGAATTTATTTCTGG - Intergenic
1203688765 Un_GL000214v1:22405-22427 CTGAATCCTGAATTATTTCCTGG + Intergenic
1203699250 Un_GL000214v1:122470-122492 CCACATCCTGCGTTTTTTTGGGG - Intergenic
1203753844 Un_GL000218v1:105319-105341 CTGAATCCTGAATTATTTCCTGG - Intergenic
1203713247 Un_KI270742v1:117851-117873 CTGAATCCTGAATTATTTTCTGG - Intergenic
1203537960 Un_KI270743v1:60200-60222 CTGAATCCTGAATTATTTCCTGG + Intergenic
1203647510 Un_KI270751v1:81648-81670 CTGAATCCTGAATTATTTCCTGG - Intergenic
1186632546 X:11365710-11365732 CCAATACCTGAATTATTTTATGG - Intronic
1187747331 X:22423787-22423809 GTAAATCCTTAATTATTTTCTGG + Intergenic
1188831812 X:34907444-34907466 TCAAATCCTGAAATCTTTTAAGG + Intergenic
1189887851 X:45567324-45567346 CCTAATCCTGAATTTGATTCAGG - Intergenic
1190543358 X:51500197-51500219 CCAAGTCCTAAATATTTTTTAGG - Intergenic
1191607377 X:63077579-63077601 CCAATTCCTGAGATCTTTTCAGG - Intergenic
1191730459 X:64329192-64329214 GAAAATCCCGAGTTTTTTTCTGG + Intronic
1193398972 X:81020151-81020173 CCAAATTCTGAATTCTTTGTTGG + Intergenic
1193590733 X:83385472-83385494 CAAACTTCTGAATTCTTTTCTGG - Intergenic
1193659298 X:84237677-84237699 CCAAGTCCTGAGTTATATTCTGG - Intergenic
1193690494 X:84635370-84635392 CAACCTTCTGAATTTTTTTCTGG - Intergenic
1193994794 X:88352262-88352284 CTAAATCCTAAAATTTTTCCTGG - Intergenic
1194461336 X:94173047-94173069 CCAAATACTTATTTTTTTTGTGG + Intergenic
1194611049 X:96045725-96045747 CCCAAAGCAGAATTTTTTTCAGG - Intergenic
1195350819 X:103995368-103995390 ATGAATCCTGAATTCTTTTCTGG + Intergenic
1195877671 X:109559109-109559131 CAAAATCCTAAATTTTTTAAAGG + Intergenic
1196076074 X:111577510-111577532 CTGAATCCTGAATTCTTTCCTGG + Intergenic
1196389834 X:115195821-115195843 CCAAATCCTGAATCTGATTTAGG + Intronic
1197234739 X:124048181-124048203 CCTGATCTTGAATTTTTTTGGGG + Intronic
1197449941 X:126599990-126600012 CTAAATCATGAATTTTTTGTGGG - Intergenic
1198546297 X:137696147-137696169 TCAGATCCTAAATTTGTTTCTGG + Intergenic
1199098404 X:143768394-143768416 CCGTCTCCTGAATTTTTATCTGG + Intergenic
1199792036 X:151164351-151164373 CCAAATCCTGATTGTCTTTAGGG - Intergenic