ID: 1037400792

View in Genome Browser
Species Human (GRCh38)
Location 8:18493541-18493563
Sequence CCAATGCCACCAAAGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037400792_1037400795 8 Left 1037400792 8:18493541-18493563 CCACCATGCTTTGGTGGCATTGG No data
Right 1037400795 8:18493572-18493594 AATTTGAACATCCAAGAGATTGG No data
1037400792_1037400797 25 Left 1037400792 8:18493541-18493563 CCACCATGCTTTGGTGGCATTGG No data
Right 1037400797 8:18493589-18493611 GATTGGAAGCCATCAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037400792 Original CRISPR CCAATGCCACCAAAGCATGG TGG (reversed) Intergenic
No off target data available for this crispr