ID: 1037400797

View in Genome Browser
Species Human (GRCh38)
Location 8:18493589-18493611
Sequence GATTGGAAGCCATCAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037400792_1037400797 25 Left 1037400792 8:18493541-18493563 CCACCATGCTTTGGTGGCATTGG No data
Right 1037400797 8:18493589-18493611 GATTGGAAGCCATCAGCAGCTGG No data
1037400794_1037400797 22 Left 1037400794 8:18493544-18493566 CCATGCTTTGGTGGCATTGGCTA No data
Right 1037400797 8:18493589-18493611 GATTGGAAGCCATCAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037400797 Original CRISPR GATTGGAAGCCATCAGCAGC TGG Intergenic
No off target data available for this crispr