ID: 1037401942

View in Genome Browser
Species Human (GRCh38)
Location 8:18502621-18502643
Sequence TGCTTGACCCCGGCAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037401935_1037401942 9 Left 1037401935 8:18502589-18502611 CCCAGCTGCATGGGAGGCTGAGG 0: 36
1: 4980
2: 109381
3: 218684
4: 353576
Right 1037401942 8:18502621-18502643 TGCTTGACCCCGGCAGGCGGAGG No data
1037401937_1037401942 8 Left 1037401937 8:18502590-18502612 CCAGCTGCATGGGAGGCTGAGGT No data
Right 1037401942 8:18502621-18502643 TGCTTGACCCCGGCAGGCGGAGG No data
1037401933_1037401942 17 Left 1037401933 8:18502581-18502603 CCTGTAATCCCAGCTGCATGGGA 0: 13
1: 2351
2: 58782
3: 166054
4: 572958
Right 1037401942 8:18502621-18502643 TGCTTGACCCCGGCAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037401942 Original CRISPR TGCTTGACCCCGGCAGGCGG AGG Intergenic
No off target data available for this crispr