ID: 1037403976

View in Genome Browser
Species Human (GRCh38)
Location 8:18522253-18522275
Sequence GTGGGGATAAGCAGCGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037403972_1037403976 -8 Left 1037403972 8:18522238-18522260 CCTCAAGGTGGATCCGTGGGGAT No data
Right 1037403976 8:18522253-18522275 GTGGGGATAAGCAGCGAGGGAGG No data
1037403968_1037403976 -1 Left 1037403968 8:18522231-18522253 CCAGGTGCCTCAAGGTGGATCCG No data
Right 1037403976 8:18522253-18522275 GTGGGGATAAGCAGCGAGGGAGG No data
1037403966_1037403976 4 Left 1037403966 8:18522226-18522248 CCAGGCCAGGTGCCTCAAGGTGG No data
Right 1037403976 8:18522253-18522275 GTGGGGATAAGCAGCGAGGGAGG No data
1037403961_1037403976 23 Left 1037403961 8:18522207-18522229 CCATTTCAGGAGGGCCAGGCCAG No data
Right 1037403976 8:18522253-18522275 GTGGGGATAAGCAGCGAGGGAGG No data
1037403964_1037403976 9 Left 1037403964 8:18522221-18522243 CCAGGCCAGGCCAGGTGCCTCAA No data
Right 1037403976 8:18522253-18522275 GTGGGGATAAGCAGCGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037403976 Original CRISPR GTGGGGATAAGCAGCGAGGG AGG Intergenic
No off target data available for this crispr