ID: 1037405256

View in Genome Browser
Species Human (GRCh38)
Location 8:18535820-18535842
Sequence CAGTGATTGGAGAAGTATCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037405252_1037405256 6 Left 1037405252 8:18535791-18535813 CCTCTCTGACACGTTACGCTTGA 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1037405256 8:18535820-18535842 CAGTGATTGGAGAAGTATCCGGG 0: 1
1: 0
2: 1
3: 12
4: 120
1037405251_1037405256 10 Left 1037405251 8:18535787-18535809 CCTTCCTCTCTGACACGTTACGC 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1037405256 8:18535820-18535842 CAGTGATTGGAGAAGTATCCGGG 0: 1
1: 0
2: 1
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037405256 Original CRISPR CAGTGATTGGAGAAGTATCC GGG Exonic
903548655 1:24142730-24142752 CAGTGAATGGAGAATTGGCCTGG - Intronic
911452054 1:98075585-98075607 CATTGGTTTGAGAATTATCCAGG + Intergenic
912657566 1:111500759-111500781 CAACGATTGGAGAAAAATCCAGG + Intronic
915592950 1:156880834-156880856 GAGTGATTGGAGAAGGGGCCTGG - Intronic
916350638 1:163845743-163845765 CAGTAATTGTAGAGGTATCATGG - Intergenic
917487135 1:175465671-175465693 GAGGGAGTGAAGAAGTATCCAGG + Intronic
918570117 1:185980532-185980554 CAATGACTGGAGAAGTCTGCTGG - Intronic
919340265 1:196298059-196298081 CAGTGATTGGAGATATCTTCTGG - Intronic
919982067 1:202647976-202647998 CAGTGGTGGGAGTAGAATCCTGG + Intronic
922785983 1:228282458-228282480 CACGGATTGGAAAAGAATCCAGG - Intronic
923264634 1:232302462-232302484 CAGAGAATGGAGAAATAACCAGG - Intergenic
924794702 1:247284934-247284956 CAGAGATTTGAGAAGTATTTGGG - Intergenic
1064481324 10:15743629-15743651 CAGTGCTTGGAGTGGTATTCTGG + Intergenic
1070245817 10:74730468-74730490 CTGTGATGGGAGGAGTGTCCTGG - Intergenic
1072158345 10:92743956-92743978 CAGTGATTGAAGAAGACTCCTGG + Intergenic
1075816935 10:125271686-125271708 GAGTGATTGGAAAAGCATCTGGG + Intergenic
1076250084 10:128978456-128978478 CAGTGATTGGTCAAGCCTCCAGG - Intergenic
1086429567 11:86722368-86722390 AAGTGATTGGACAAATTTCCAGG - Intergenic
1088213241 11:107479745-107479767 AAGTGATTTGAGAAGTTTTCTGG - Intergenic
1091957178 12:4655829-4655851 CAGTGATTGGGGAGCTGTCCTGG + Intronic
1093678392 12:21971077-21971099 CTGTAATTGGAGATGTATTCTGG - Intergenic
1093977833 12:25442006-25442028 CATTGATTAAAGATGTATCCAGG - Intronic
1094406972 12:30126571-30126593 CAGAGATTGAAGCAGTTTCCTGG + Intergenic
1100189524 12:92175964-92175986 CAGTGTTTTGAAAATTATCCTGG - Intergenic
1102962558 12:117102052-117102074 CAGGGCTTGGAGAAGTAATCAGG + Intergenic
1103370521 12:120415821-120415843 CAGTGATTGGTGAGGTATCCTGG + Intergenic
1105610838 13:21968508-21968530 CAGCAGTTGAAGAAGTATCCTGG - Intergenic
1106570293 13:30921098-30921120 CAGTGATTGGAGAAAGTTACCGG + Exonic
1108800838 13:54092760-54092782 CAGTAATTGGAAAAGTGGCCAGG - Intergenic
1110542526 13:76721829-76721851 TAGTAAGAGGAGAAGTATCCAGG + Intergenic
1111318049 13:86586517-86586539 CAGTGGTCTGAGATGTATCCAGG - Intergenic
1112652069 13:101410272-101410294 CAGTGATGGGAGAGGTGTGCAGG - Intronic
1113295715 13:108956547-108956569 ATGAGATTGGAGAAGTAGCCAGG - Intronic
1116798503 14:49417183-49417205 CAGTAATTGGGGTATTATCCTGG + Intergenic
1117898904 14:60513578-60513600 CAGTGTTTGGAGAAGTTTGTTGG + Intronic
1118511630 14:66480986-66481008 CTGTGATTGGAGAAGAAACCTGG + Intergenic
1121466002 14:94115933-94115955 CAGTCACTGGGTAAGTATCCTGG + Exonic
1123936052 15:25194589-25194611 GCGTGCTTGGAGAAGGATCCTGG + Intergenic
1125257350 15:37780487-37780509 CAGTGATTCTAGAAGTAACCAGG + Intergenic
1125681744 15:41535089-41535111 CAGTGAGTGGAGAAGCCACCTGG - Intronic
1127134752 15:55908299-55908321 AATTGATTAGAGAAGTATTCTGG - Intronic
1128609869 15:69064967-69064989 CAGTGTTTGGAGAAGGATGCAGG - Intergenic
1128882495 15:71256539-71256561 CAGGGTTTGGAAATGTATCCTGG + Intronic
1131354308 15:91731341-91731363 CAGTTATTGGCTAAATATCCTGG + Intergenic
1132065548 15:98727879-98727901 CAGGGACTGGAGAACTTTCCAGG - Intronic
1133873756 16:9713838-9713860 CAGTGATTGGGGAAGAACCTTGG - Intergenic
1133969218 16:10555172-10555194 GGGTGATTGGAGGAGTAGCCAGG - Intronic
1139319518 16:66102334-66102356 CAGTGAATGGGGAAGTATGAGGG + Intergenic
1140213405 16:72988385-72988407 CAGTGGCTGGAGAAGGATCTTGG - Intronic
1145934608 17:28707490-28707512 CAGTGGTTGCAGGAGTTTCCAGG - Intronic
1149816638 17:59731684-59731706 CAGTGATGGCAGAAGGAGCCTGG + Intronic
1158535582 18:58305421-58305443 CAGTGATTTGAGAACTTTGCAGG + Intronic
1165703069 19:37953185-37953207 CATTCATTTGAGAAGGATCCTGG - Intronic
926605739 2:14896729-14896751 CAGTGAGTGAAGAAGTCTGCAGG + Intergenic
932998163 2:76883100-76883122 CAGTGAGTGGCTATGTATCCAGG + Intronic
933884285 2:86703437-86703459 TAGGGATTGGAGAAGTACCCCGG + Intronic
935524102 2:104144493-104144515 CTGTGCTTGAAGAAGTATCAAGG - Intergenic
935832864 2:107018792-107018814 CAGGAATTGGAGAAGCAGCCAGG + Intergenic
936531609 2:113279971-113279993 CAAAGATTGGAGGAGCATCCAGG - Intergenic
943705826 2:191033159-191033181 CAGAAATTGGAGAAATATACAGG + Intronic
943808338 2:192151991-192152013 GAGTGGTTGGGGAAGTATTCAGG + Intronic
944565597 2:200987307-200987329 CAGTTGCTGGAGAAGGATCCTGG - Intronic
947217882 2:227766093-227766115 AAGTTATTTGAGAAGTTTCCTGG - Intergenic
1170633791 20:18087405-18087427 CAGTGATTCTAGAAGTATTCTGG - Intergenic
1172305632 20:33878299-33878321 CAGTGCTGGGAGCCGTATCCTGG + Intergenic
1174711891 20:52715531-52715553 ATGTGACTGGAGAATTATCCAGG - Intergenic
1174766648 20:53260593-53260615 CAGTGTTTGGAAAAGAATGCTGG + Intronic
1175482285 20:59320281-59320303 CAGTCATTAGAGATGCATCCCGG - Intronic
1177973785 21:27823108-27823130 CAGTTATTGTACAAATATCCTGG - Intergenic
950252946 3:11482102-11482124 CAGTGATGAGAGAAGGAACCGGG - Intronic
955742304 3:62104394-62104416 CAGGGATTAAAGAAGTATTCTGG - Intronic
959653652 3:108776372-108776394 CAGTGGGGGGAGAAGGATCCAGG + Intergenic
959790274 3:110352622-110352644 CAGTGATAGGAAAAGATTCCTGG - Intergenic
960002741 3:112749754-112749776 CAGTGATTGGTCCAGGATCCAGG + Intronic
960640640 3:119819538-119819560 CAATGTTTGGAGAACTACCCTGG - Intergenic
961427528 3:126859790-126859812 CAGTGAGTGGAGAAGAGTCCAGG + Intronic
961441471 3:126955768-126955790 CAGTGAGTGGAGGAGAAACCTGG + Intronic
965276706 3:166692478-166692500 CAGTCCTTGGAGAAGTATAGGGG - Intergenic
967128210 3:186445772-186445794 CAGGTTTTGGAGAAGTGTCCAGG - Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967233493 3:187363488-187363510 CAGAGGTTGGACAAGTGTCCTGG + Intergenic
973032137 4:45358653-45358675 CAGTGATTTAACAAGTCTCCAGG - Intergenic
976566900 4:86561539-86561561 CAGTGAATGAAGAACTATTCTGG + Intronic
977027293 4:91834991-91835013 CAGTGATGGGAGAGGTAAGCTGG + Intergenic
977974624 4:103250136-103250158 AAGTGATTTGAGAAGTTTTCTGG - Intergenic
982535023 4:156599939-156599961 CTGTGATAGGAGAAGTATACAGG + Intergenic
983115203 4:163806700-163806722 AAGTGATGGGAAAAGCATCCTGG + Intronic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
985221588 4:187711689-187711711 CAGTCCTTGGAGGAGTTTCCAGG + Intergenic
986201073 5:5579261-5579283 TAGAGACTGGAAAAGTATCCTGG + Intergenic
987898877 5:23984678-23984700 CAGTGATTGGGGAGGAGTCCAGG - Intronic
992244447 5:74805254-74805276 CAATACTTTGAGAAGTATCCAGG - Exonic
993568210 5:89502129-89502151 CAATGGCTGGAGGAGTATCCAGG + Intergenic
994028386 5:95112197-95112219 TAGTTATTGGGAAAGTATCCAGG - Intronic
994083656 5:95734893-95734915 GAGTTACTGGAGAGGTATCCGGG - Intronic
996380632 5:122859393-122859415 CAGGGATTTGAGGAGTAGCCTGG + Intronic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1001198852 5:169697880-169697902 CTGTGATTCCAGAGGTATCCTGG - Intronic
1005485778 6:26298003-26298025 TAGTGTTTGTAGAAGTATCAAGG - Intergenic
1005601330 6:27429336-27429358 CAGTCATTAGAGAAGCAGCCTGG + Intergenic
1006932365 6:37696027-37696049 CAGAGTTTGGACACGTATCCCGG + Intronic
1007455752 6:41975697-41975719 CAGTGAGTGGAGAGGTAGCCTGG - Intronic
1008023832 6:46611061-46611083 CAGGGATTGTAGCAGTAGCCTGG + Intronic
1008064644 6:47034517-47034539 CACAGATTGGTGAAGTGTCCTGG - Intronic
1009548898 6:65060361-65060383 CAGTGATTGTAGAATCATCTTGG - Intronic
1011811498 6:91137306-91137328 TAGAGATTGGAGAAGTAGCCTGG + Intergenic
1012007777 6:93736043-93736065 CAGTGTTTGGGGAAGTCTCCAGG - Intergenic
1012491501 6:99787619-99787641 CAGGGCCTGGAGAAGTGTCCAGG + Intergenic
1013292922 6:108734069-108734091 CTGTGATTGCACAAGTCTCCAGG - Intergenic
1016042897 6:139450755-139450777 CTGTGATTTGAGAAGTGTTCAGG + Intergenic
1016440189 6:144075329-144075351 CTGTAACTGGAGAAGTTTCCTGG - Intergenic
1017673725 6:156793183-156793205 CTGTGATTGGAGAAGAAGCAAGG + Intronic
1018179033 6:161204318-161204340 CAGTGATTGAAAATGTATTCGGG - Intronic
1027373046 7:77527574-77527596 CATTGAGTGGAGAATTATCTGGG + Intergenic
1028962107 7:96761034-96761056 AAGTGAAGGGAGAAGTATTCAGG - Intergenic
1028974610 7:96897840-96897862 CAGTGATTACAGAAGTCTCAGGG - Intergenic
1032402532 7:131633760-131633782 CAGTGCTTGGAGGAGGATGCTGG - Intergenic
1036214523 8:6867744-6867766 CTCAGATTGGAGAAGTATACTGG + Intergenic
1036917288 8:12816313-12816335 CAGTGCTTGGAGAAATCTCCAGG + Intergenic
1037405256 8:18535820-18535842 CAGTGATTGGAGAAGTATCCGGG + Exonic
1037526655 8:19730990-19731012 CAGAGAATGGAGAATTAACCAGG + Intronic
1044505905 8:93018988-93019010 CAGTGATGGGAGAAATAATCTGG + Intergenic
1046812494 8:118548122-118548144 CAGAGAATGGACAAGCATCCAGG + Intronic
1051213172 9:14766925-14766947 AATTGACTGAAGAAGTATCCCGG - Intronic
1051590344 9:18771060-18771082 CAGTGTGTGGAAAAGAATCCTGG - Intronic
1051593423 9:18799327-18799349 CAGAGATTGGAGAATCATCTTGG + Intronic
1057169725 9:92954451-92954473 AGGTGATTGGAGAAGCAGCCGGG + Intronic
1058012630 9:99995199-99995221 AAGTGATTTGAGCAGTATACAGG - Intronic
1061104749 9:128521055-128521077 CAGTCAGTGGAGAAATAGCCAGG - Intronic
1186662740 X:11685599-11685621 AAGGGGTTGGAGAGGTATCCAGG - Intergenic
1195962872 X:110403493-110403515 ACGTGTTTGGAGAAGGATCCGGG - Intronic
1199471082 X:148197389-148197411 AAGTGTTTTGAGAAGTAGCCTGG + Intergenic
1200334563 X:155335827-155335849 CAGTGAATGGATCAGCATCCTGG - Intergenic
1200361367 X:155610896-155610918 CAGTGAATGGATCAGCATCCTGG + Intronic