ID: 1037405493

View in Genome Browser
Species Human (GRCh38)
Location 8:18538071-18538093
Sequence ATGCTGCACCTGAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037405483_1037405493 30 Left 1037405483 8:18538018-18538040 CCTAAAGCTGCTGCCCCGTGACA 0: 1
1: 0
2: 1
3: 12
4: 108
Right 1037405493 8:18538071-18538093 ATGCTGCACCTGAGGAAAAATGG No data
1037405489_1037405493 15 Left 1037405489 8:18538033-18538055 CCGTGACATGGGCAGTAGGTATG 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1037405493 8:18538071-18538093 ATGCTGCACCTGAGGAAAAATGG No data
1037405488_1037405493 16 Left 1037405488 8:18538032-18538054 CCCGTGACATGGGCAGTAGGTAT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1037405493 8:18538071-18538093 ATGCTGCACCTGAGGAAAAATGG No data
1037405487_1037405493 17 Left 1037405487 8:18538031-18538053 CCCCGTGACATGGGCAGTAGGTA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1037405493 8:18538071-18538093 ATGCTGCACCTGAGGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037405493 Original CRISPR ATGCTGCACCTGAGGAAAAA TGG Intronic
No off target data available for this crispr