ID: 1037405786

View in Genome Browser
Species Human (GRCh38)
Location 8:18541058-18541080
Sequence TAGATTTTGATGGCCAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 374}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037405786 Original CRISPR TAGATTTTGATGGCCAGGGA AGG (reversed) Intronic
901372905 1:8815942-8815964 TTGATTTTGATGGCCTGGGATGG - Intronic
903267580 1:22167213-22167235 TAGATAGTGGTGGGCAGGGAAGG - Intergenic
903874307 1:26462309-26462331 TAGAATATGACGGCCAGGCATGG - Intronic
904909264 1:33921855-33921877 TATGGTTTGGTGGCCAGGGAAGG + Intronic
904922916 1:34022752-34022774 GAGGTTTTGATGGCCAGGTAAGG + Intronic
905071992 1:35234515-35234537 TACAATTTGTTGGCCAGGCACGG + Intergenic
905612566 1:39367235-39367257 TATATTTGTATGGCCAGGCACGG - Intronic
906477165 1:46177042-46177064 TATATATTGTTGGCCAGGCATGG + Intronic
906546757 1:46625000-46625022 TAGATTCTGTTGGCCTGGGGTGG - Intergenic
907830245 1:58057941-58057963 TAGACTTGGATGGTCAGGGAAGG - Intronic
907952319 1:59195727-59195749 TACATTTTGATGGGAAGGCAGGG + Intergenic
908003381 1:59703611-59703633 TAGAAGTAGATGCCCAGGGAAGG - Intronic
909406657 1:75297579-75297601 TAAATTTTTATGGCCAGGTGTGG - Intronic
909568460 1:77081547-77081569 AATATTTTGCTGGCCAGGCACGG - Intergenic
909655944 1:78032677-78032699 TACATTTTCATGGCCAGGTGTGG - Intronic
909908094 1:81223625-81223647 TATATATTTAGGGCCAGGGACGG + Intergenic
910272590 1:85412708-85412730 AATATTTTGAGGGCCAGGCATGG + Intronic
910568981 1:88679208-88679230 AAGATTTTGAAAGCCAGGCAGGG - Intergenic
910845444 1:91600947-91600969 TAGATTGTGGGGTCCAGGGAGGG - Intergenic
910917881 1:92310605-92310627 TAAATTTTTATGGCCAGGTGTGG + Intronic
911168523 1:94746253-94746275 AAGATTTTGATGGAGAGGGGAGG - Intergenic
911506494 1:98758648-98758670 TATATTTTGAAGGCCAGGCTTGG - Intronic
912111595 1:106349116-106349138 TAAATTTTCATGGCCATGGGAGG - Intergenic
912263458 1:108131681-108131703 GAGATTTGGAGGGCCAGGGGTGG - Intergenic
912524053 1:110267541-110267563 GAAGTTTTGCTGGCCAGGGAAGG - Intronic
913133889 1:115868589-115868611 TAAATCTTGATGTCCAGAGAGGG + Intergenic
915097629 1:153474701-153474723 TAGATTGTGATGCACAGAGACGG + Intergenic
915241482 1:154525601-154525623 TAGACATTAATGGCCAGGCACGG + Intronic
916826725 1:168449043-168449065 TAGCTTTTGATGCCCAGAGTAGG + Intergenic
917589173 1:176459459-176459481 TAGCTTTTGCTGTCCATGGATGG + Intergenic
919716221 1:200779553-200779575 GAAATTGTGATGCCCAGGGAGGG + Intronic
920061961 1:203233084-203233106 TAGGACTTGAGGGCCAGGGAGGG - Intronic
920902800 1:210128080-210128102 TAGATTTTTAAGGCCAGGTATGG + Intronic
921018635 1:211215541-211215563 TAGTTTTTTATGGCCAGGCGTGG - Intergenic
921386810 1:214577882-214577904 GAGATTTGGAGGGCCAGGGGAGG + Intergenic
921662259 1:217818253-217818275 TAAATTGTGATGTCCAAGGATGG - Intronic
922218416 1:223539540-223539562 TTGATTCTGAAGGCTAGGGAGGG + Intronic
922531106 1:226345964-226345986 TAAATTTTTCTGGCCAGGTACGG + Intergenic
922777211 1:228220528-228220550 TAGCTTGAGATGGGCAGGGATGG - Intronic
923702423 1:236312706-236312728 TGGATTTTGATATCCATGGAGGG + Intergenic
1063447682 10:6129835-6129857 TAGATTTGGCTGGCCAGGCGTGG - Intergenic
1064724026 10:18259273-18259295 TAGACTTTAAAGGCCAGGCATGG + Intronic
1065546456 10:26826547-26826569 TAGCCTTTGAAGGCCAGGCATGG + Intronic
1067905979 10:50291624-50291646 TGGTTTTTGATGGCTATGGATGG - Intergenic
1069380523 10:67839639-67839661 TAGAATTTTAAGGCCAGGCACGG + Intergenic
1069646304 10:70000755-70000777 TAGAAATTGAAGGCCAGGCATGG - Intergenic
1071152092 10:82647738-82647760 CATTTTTTGATGGCCAGTGATGG + Intronic
1071172114 10:82878622-82878644 TTGATTTTTATGGGCAGCGATGG + Intronic
1071813956 10:89212385-89212407 TGGAATTTGATGGCCAGCCATGG - Intergenic
1072665117 10:97387056-97387078 TAGATTTTTATGTCCATGGGGGG - Intronic
1072926818 10:99623052-99623074 TACATTTGTATGGCCAAGGAAGG + Intergenic
1073507058 10:104005022-104005044 TAGATTTTGATCCCCAGTGCTGG + Intronic
1073879161 10:107959662-107959684 CAGATTTTGAAGTCCAGTGAGGG - Intergenic
1074070927 10:110068538-110068560 TGGATTTTGGTGGCCATGGGAGG + Intronic
1074100672 10:110352558-110352580 GTGATTTTGAAGTCCAGGGAGGG + Intergenic
1074304648 10:112265574-112265596 TAGATTTTTAAGACCAGGGTAGG + Intergenic
1074537383 10:114338234-114338256 TGGACTGTGATGGCCAGGGCAGG + Intronic
1074850143 10:117432888-117432910 TAGAGCTGGATGGCCATGGAGGG - Intergenic
1076124398 10:127962723-127962745 TGGATTGTTATGGCCAAGGAGGG + Intronic
1077723277 11:4648191-4648213 AAGATTTAGCTGGCCTGGGAAGG - Intronic
1077812329 11:5650736-5650758 TAGTTCATGATGGCCAGGTAGGG + Intergenic
1077948554 11:6929118-6929140 TAGGTTGTCATGGCCAGGGGAGG - Intronic
1078389157 11:10920978-10921000 CAGATTTTGATAGACAGGGCTGG + Intergenic
1078633490 11:13027962-13027984 CAGATTGTGGAGGCCAGGGATGG + Intergenic
1079065638 11:17288843-17288865 TAGACTTTAAGGGCCAGGCACGG - Intronic
1079086117 11:17446254-17446276 AAGATTTTGTTGGCCAGGCATGG - Intronic
1079976875 11:27102898-27102920 AATAATTTGATGGCCAGGCATGG + Intronic
1080357041 11:31461298-31461320 AAGATTTTCATGGCCAGGCATGG + Intronic
1080598573 11:33799901-33799923 AAAATTTTGATAGCCAGGCATGG + Intergenic
1082074499 11:47965813-47965835 GATATTTTGAGGGCCAGGCACGG - Intergenic
1082780610 11:57284700-57284722 GAGATTTAGAGGGCCAGGGGCGG + Intergenic
1083559972 11:63665595-63665617 AAGATCTTGTTGGCCAGGCATGG + Intronic
1083847876 11:65346718-65346740 TTTATTTTGATGGTCAGGTATGG + Intronic
1085172105 11:74458224-74458246 TGGGTTCTGATGGTCAGGGAAGG - Intronic
1085830924 11:79900007-79900029 TGAATATTGATTGCCAGGGAAGG + Intergenic
1087276303 11:96163778-96163800 TAGATTTTCATTGCCAGAGCAGG + Intronic
1088844524 11:113653565-113653587 TAGATTAGGGTGGTCAGGGAAGG - Intergenic
1089584912 11:119504156-119504178 TTGGCTTGGATGGCCAGGGAAGG + Intergenic
1091717308 12:2788032-2788054 AGGATTTTGTTGGCCAGGCATGG - Intergenic
1092590388 12:9947798-9947820 AATATTTTGGTGGCCAGGCACGG - Intergenic
1093176983 12:15923472-15923494 AAGATTATGCTGGCCAGAGAAGG - Intronic
1094433156 12:30392747-30392769 TTCATTTTGCTGGCCAGGCATGG + Intergenic
1095190053 12:39247529-39247551 CAGATTTTTCTGGCCAGGCATGG + Intergenic
1095800190 12:46264032-46264054 CAGATTTAGTTGGCCTGGGATGG - Intronic
1096274478 12:50194277-50194299 TATATGTTGCTGGCCAGGCACGG - Intronic
1097608574 12:61787246-61787268 CAGCTTTTGCTGGTCAGGGAAGG - Intronic
1097933821 12:65222031-65222053 AAGATTTTCCTGGCCAGGCATGG - Intronic
1098587926 12:72176359-72176381 TAGATATGGATGGCTTGGGAAGG + Intronic
1098589836 12:72197812-72197834 GAAAATATGATGGCCAGGGAAGG - Intronic
1100725352 12:97402817-97402839 TAGACTATGGTGGCCAGGCATGG + Intergenic
1102301206 12:111772865-111772887 TAGATTTAGGTGGCCGGGCATGG + Intronic
1102350804 12:112190754-112190776 TAGATTCCGATCCCCAGGGAAGG + Intronic
1103088963 12:118083829-118083851 AAAGTTTTGCTGGCCAGGGACGG + Intronic
1103433995 12:120910289-120910311 CAGAATTTGATGGGGAGGGAGGG - Intergenic
1103447379 12:121002988-121003010 TAGAAGCTCATGGCCAGGGATGG - Intronic
1104009000 12:124915501-124915523 TACATTCTGAGGGCCAGGTATGG + Intronic
1104030003 12:125058140-125058162 CAGAATTTGGAGGCCAGGGAGGG + Intergenic
1105868809 13:24485972-24485994 TACATATTTATGGCCAGGCATGG - Intronic
1109199920 13:59418929-59418951 AAGATTTTGAAGGCCAAGCATGG + Intergenic
1109782819 13:67134825-67134847 TAAATTTTGATGGCGAGTCAAGG - Intronic
1110084633 13:71363248-71363270 TACATTTGGATGGCCAGTGGTGG - Intergenic
1110748951 13:79090408-79090430 AAGATTTGGATGGGCAGTGATGG - Intergenic
1110749436 13:79095550-79095572 AAGATTTGGATGGGCAGTGATGG - Intergenic
1111648563 13:91062398-91062420 AAGATTTTGCAGGCCAGGCACGG + Intergenic
1112688655 13:101863374-101863396 TGGATGTTGATGGCCAGTGATGG + Intronic
1113309083 13:109112463-109112485 TAATTTTTGATGGCCGGGCATGG + Intronic
1114082311 14:19211577-19211599 GAGATTTGAAGGGCCAGGGATGG + Intergenic
1114717744 14:24845300-24845322 AAGCTTTTGATGGCCAGGCGCGG - Intronic
1116519534 14:45832292-45832314 TAGTTTTTAATATCCAGGGATGG - Intergenic
1116883145 14:50192262-50192284 CAGATTTTTCTGGCCAGGCATGG + Intronic
1117336741 14:54762472-54762494 TGGAGCTTGATGGCCAGGGTGGG + Intronic
1117657881 14:57974901-57974923 TAGATTTTGATGCCTAGCTAGGG - Intronic
1119472479 14:74908624-74908646 TAGAGTGGGATGGTCAGGGAAGG - Intronic
1119784854 14:77305386-77305408 TTTATTTTGATGGACAGGTAGGG - Intronic
1121052602 14:90829290-90829312 GAGATTGTGTGGGCCAGGGAAGG + Intergenic
1121532642 14:94668145-94668167 TATATTTGGATGGCCAGGCGCGG + Intergenic
1121671786 14:95715584-95715606 TGGACTTTTGTGGCCAGGGAAGG + Intergenic
1125198210 15:37072827-37072849 AAGATTTTGATGGTGGGGGAAGG - Intronic
1125281083 15:38043251-38043273 TGGCATTTGATGGCCAGGGCTGG + Intergenic
1125475592 15:40046208-40046230 GGGATTTTGATGGGGAGGGAGGG - Intergenic
1126350861 15:47743594-47743616 CAGATTTTCATGGCCGGAGAAGG + Intronic
1126539654 15:49807912-49807934 TACCCTTTGATGGACAGGGAAGG - Intergenic
1127192923 15:56551015-56551037 TAGAGTTAGAAGGCCTGGGATGG - Intergenic
1127411917 15:58717576-58717598 TAGATTTCCATGCCCATGGAAGG - Exonic
1127590939 15:60422544-60422566 TAGCTTATGCTGGCCAGGCACGG + Exonic
1128775340 15:70316119-70316141 TGGCCTTTGATGGGCAGGGAAGG - Intergenic
1128799931 15:70490843-70490865 TTGATTCTGATGCCCAGTGAAGG - Intergenic
1128899367 15:71406073-71406095 AATACTTTGAGGGCCAGGGACGG - Intronic
1129707745 15:77804402-77804424 TAGAAGTAGATGGCCAGAGAGGG + Intronic
1131117943 15:89805893-89805915 TGGATTCTGAGGGCCAAGGAAGG - Intronic
1131378638 15:91945885-91945907 TGGATTGTGATGGAGAGGGAGGG + Intronic
1132910816 16:2309908-2309930 AAGATTTTGATGGCTGGGCACGG - Intronic
1132929681 16:2452457-2452479 CAGCTTTTGGTGGCCAGGGTTGG - Intronic
1133478070 16:6142509-6142531 TGGATTTTTTTGGCCAGGCATGG - Intronic
1133595990 16:7293346-7293368 TAGATTTTGGTGTCCTTGGAAGG + Intronic
1134392720 16:13834311-13834333 TGGATTTTGATAGTCAGGAAAGG - Intergenic
1134594327 16:15483668-15483690 TAGATTTTTCTGGCCAGGCACGG - Intronic
1134741851 16:16554833-16554855 GGGATTTTGATGGGCAGAGATGG - Intergenic
1134925708 16:18157623-18157645 GGGATTTTGATGGGCAGAGACGG + Intergenic
1135476800 16:22783858-22783880 CAGATGGTGATGGCCAAGGAGGG - Intergenic
1135998576 16:27272323-27272345 TAGAATTTGATGGCCAACAAAGG + Intronic
1136665693 16:31810581-31810603 CAGATTTTGGGGGCCAGGCACGG + Intergenic
1137677850 16:50312698-50312720 AAGAATTGGGTGGCCAGGGAGGG - Intronic
1137927031 16:52549373-52549395 TAGATTTTGATTTAGAGGGAGGG + Intergenic
1137992923 16:53178195-53178217 TAAATTGTGAAGCCCAGGGAAGG + Intronic
1139486697 16:67261141-67261163 TAGCTGTGGCTGGCCAGGGAAGG + Intronic
1140145882 16:72308114-72308136 TAGATTTTGACAGACAGGCATGG - Intergenic
1142015462 16:87743986-87744008 TAGAATTTGAGGGCCAGGCGTGG + Intronic
1142721802 17:1781209-1781231 GAGGTTTTGCTGGCCAGGTATGG - Exonic
1142945574 17:3423640-3423662 AAGAATTTGATGACCAGGCATGG + Intergenic
1143235570 17:5397047-5397069 TAAATTTTGATGGCCAGGTGCGG + Intronic
1146188146 17:30739664-30739686 AATGCTTTGATGGCCAGGGACGG - Intergenic
1147377215 17:40029715-40029737 AAGACTGTGGTGGCCAGGGAAGG + Intronic
1148405508 17:47410457-47410479 TGAATTTTGAGGGCCAGGGATGG - Intronic
1149392752 17:56208422-56208444 AGGATTTTGAGGGGCAGGGAGGG - Intronic
1151545797 17:74792158-74792180 AAGAATTTAATGGCCAGGCATGG + Intronic
1151888407 17:76937814-76937836 TAGGTTTTCAGGGCCAGAGAGGG + Intronic
1153912797 18:9718977-9718999 TACAATTTGAAGGCCAGGCATGG + Intronic
1155498752 18:26466534-26466556 TGGAATTTGATGGGTAGGGAGGG + Intronic
1155824750 18:30426019-30426041 TAGATTATGATGGCTACTGATGG - Intergenic
1156878473 18:42045595-42045617 TAGTTTCTGAAGGCCAGGGCTGG + Intronic
1157382415 18:47231435-47231457 CAAATTTTGATGGCCCGAGAAGG - Intronic
1157418320 18:47524553-47524575 TTTAGTTTGATGGCCAGGGAAGG - Intergenic
1158204479 18:54976563-54976585 TAGATTTTCATAGCCTAGGAAGG - Intergenic
1158691112 18:59661675-59661697 TAGATTCTGTTGGCCCGGCATGG + Intronic
1158714312 18:59864124-59864146 TATATTTTTAAGGCCAGGCACGG - Intergenic
1161192377 19:2965448-2965470 TGGGTTTTGAGGGCCAGGCACGG - Intergenic
1161359685 19:3840899-3840921 TAGATTTTGATGGCCATGCATGG + Intronic
1162332568 19:10039158-10039180 CAGAGTCTGATGGCCAAGGATGG + Intergenic
1162932960 19:13966341-13966363 GTGATTTTGATGGCCAGGGTTGG - Intronic
1163910644 19:20188388-20188410 TACATTTTCAGGGCCAGGCATGG + Intronic
1164475606 19:28573648-28573670 TAAATTTGGAAGGCCAGGGTTGG + Intergenic
1164795022 19:31019371-31019393 GTGTTGTTGATGGCCAGGGAAGG - Intergenic
1166027229 19:40098345-40098367 TATATTGAGATGGCCAGGCACGG + Intergenic
1167248319 19:48387390-48387412 TATGTTTTGAAGGCCAGGCACGG + Intronic
925778558 2:7357930-7357952 TAGAGTTTGATGGCCAGGTTTGG + Intergenic
925934667 2:8744252-8744274 TAGCTTGTGATGTCCAGGGAGGG - Intronic
929052056 2:37845991-37846013 TGGATTTTAATGGCTATGGAGGG - Intergenic
930248217 2:49006408-49006430 TAGATTTGGATGGATAGGGTTGG - Intronic
930290692 2:49489964-49489986 TAGATTTTCATGGTCAGTGTAGG - Intergenic
931201704 2:60103933-60103955 TAGATGAAGAAGGCCAGGGAGGG - Intergenic
932428553 2:71659291-71659313 GAGATTTTGATAGGCTGGGAGGG + Intronic
932573504 2:72950591-72950613 TAGTTTTTGGTGGACAGGGGAGG - Intronic
933438280 2:82276759-82276781 AAGAATTTCATGGCCAGGCACGG - Intergenic
934037263 2:88098889-88098911 AAGATTTTGATGGCAATTGAAGG - Intronic
934160862 2:89248424-89248446 TAGGTTTTGAAGGGAAGGGAAGG - Intergenic
934206414 2:89934009-89934031 TAGGTTTTGAAGGGAAGGGAAGG + Intergenic
934866823 2:97821643-97821665 TACATTTTGGTGACCAGGAAGGG + Intronic
935783679 2:106530314-106530336 TAAATTTTGAGGAACAGGGAGGG + Intergenic
936054082 2:109247667-109247689 TAGTTTCTGATTGCCAGTGAAGG + Intronic
936601916 2:113904904-113904926 TAGATGTTAATGACAAGGGAGGG - Intronic
936874920 2:117177009-117177031 TAGGTCTTGTTGGCCAGGCATGG - Intergenic
937035428 2:118777749-118777771 TATATGCTGATGGCCAGGCATGG - Intergenic
937409495 2:121660811-121660833 TATATTTTTTTGGCCAGGCACGG + Intergenic
938494276 2:131785026-131785048 GAGATTTGAAGGGCCAGGGATGG - Intergenic
939023623 2:136986245-136986267 TAGATTTGGGCAGCCAGGGATGG + Intronic
939559167 2:143713464-143713486 GAGATTTGGAGGGTCAGGGATGG - Intronic
941034397 2:160552246-160552268 TGGATTTTGGTAGCCAAGGAGGG + Intergenic
941062965 2:160868912-160868934 TAAAGTTTGACAGCCAGGGAAGG + Intergenic
941722523 2:168827140-168827162 TAGATTTTGATGAAGAGGAAGGG - Intronic
944832802 2:203549700-203549722 AGGATTTGGATGGGCAGGGAGGG - Intergenic
945016980 2:205528778-205528800 AAGATTGTGTTGGCCAGGCACGG - Intronic
945074349 2:206022880-206022902 TAGAGTTCGTTGGCCAGGCATGG - Intronic
946228897 2:218279593-218279615 TAGAGTATGGTGGCCAGGCAGGG - Intronic
947017189 2:225634093-225634115 CAGCCTTTGATGGCCAGGGAAGG + Intronic
949015361 2:241706337-241706359 TAGATTTTCTTGGCCAGGCACGG + Intronic
1169663598 20:8007809-8007831 TAAGTTAGGATGGCCAGGGAAGG - Intronic
1169820165 20:9701706-9701728 TCAATTTTGATGGCCTGGTATGG + Intronic
1171173356 20:23034474-23034496 CACATTTTAGTGGCCAGGGATGG + Intergenic
1171977084 20:31602258-31602280 TAGTTGGTGATGGCCAGGCACGG + Intergenic
1172025640 20:31946423-31946445 TGGACTTTGAAGGGCAGGGATGG - Intronic
1172643470 20:36455610-36455632 GAGACTTTGAGGCCCAGGGAAGG - Intronic
1172995203 20:39065287-39065309 TAGAGTTGGCTGGCCAGGCATGG + Intergenic
1173824690 20:46040692-46040714 GAGATTCTGAGGGGCAGGGAGGG - Intronic
1174113474 20:48211911-48211933 TAGCCTGTGATGGTCAGGGAGGG - Intergenic
1174640880 20:52043129-52043151 TGGATTTTTAAGGCCAGGCATGG - Intergenic
1174732272 20:52929534-52929556 TACATATTGAAGGCCTGGGAAGG + Intergenic
1175179402 20:57134859-57134881 TTTAGATTGATGGCCAGGGAAGG + Intergenic
1175475731 20:59272817-59272839 TTGGTTTTGCTGGCCAGGGCTGG + Intergenic
1176156100 20:63621833-63621855 AAAATTTTCATGGCCAGGCATGG + Intronic
1176416687 21:6479606-6479628 AAGAATTTTATGGCCGGGGAGGG + Intergenic
1176613641 21:9009339-9009361 GAGATTTGAAGGGCCAGGGATGG + Intergenic
1176711538 21:10154535-10154557 GAGATTTGAAGGGCCAGGGATGG - Intergenic
1178670301 21:34584211-34584233 TATCTTTTGAGGGCCAGGGAGGG - Intronic
1179692187 21:43087941-43087963 AAGAATTTTATGGCCGGGGAGGG + Intergenic
1180498465 22:15911093-15911115 GAGATTTGAAGGGCCAGGGATGG - Intergenic
1182531064 22:30957933-30957955 TAGGTTTTGATGACTAAGGAAGG - Intronic
1182608507 22:31526851-31526873 TAGGTATTGATGGCCAGGCACGG - Intronic
1184708748 22:46234656-46234678 TAGGTTTTGTAGGCCAGGCACGG - Intronic
950698635 3:14724107-14724129 TAGCTTTTTCTGGCCAGGCACGG - Intronic
951195218 3:19815957-19815979 TAGATTGGGTTGGCCAGGGGAGG - Intergenic
952445232 3:33374983-33375005 TATATTTTGATGACTAGTGAGGG + Intronic
952662236 3:35865761-35865783 TAGATTTTTTTGGCCAGGTGCGG + Intergenic
953325387 3:42008424-42008446 TAGTTTGTGAAGGCCAGGCATGG - Intergenic
954091954 3:48292053-48292075 TAAGTTTAGATGGCCAGGTATGG - Intronic
954781642 3:53066334-53066356 TCTAATATGATGGCCAGGGAGGG + Intronic
955794239 3:62618953-62618975 TAGGTATTGATGACTAGGGATGG + Intronic
957669291 3:83280404-83280426 GAGATTTGGAGGGGCAGGGATGG - Intergenic
958794394 3:98691541-98691563 TAGAATTTGTTGGCCAGGCACGG + Intergenic
958946134 3:100364105-100364127 TAGATTTTTCTGGTGAGGGAAGG - Exonic
959088784 3:101880046-101880068 TATATTTGGATGGCCAGAAAAGG + Intergenic
960287225 3:115843271-115843293 TTGATTTTTATGCCCAGGAATGG + Intronic
960311330 3:116119947-116119969 TAAATTTTCTTGGCCAGGCACGG - Intronic
960636327 3:119788406-119788428 TGTATAATGATGGCCAGGGATGG - Intronic
961294998 3:125877511-125877533 CAGATGCTGATGGCCAGGCATGG - Intergenic
962318957 3:134375465-134375487 TGGATTCTGATAGCCAGGGAGGG - Exonic
962816924 3:139008856-139008878 TAGAATGTGTTGGCCAGGGGTGG + Intronic
964334094 3:155636455-155636477 TAGATTTTGTAGGCCAGGCGCGG + Intronic
964556709 3:157947573-157947595 AAGTTTTTCATGGCCAGGCATGG - Intergenic
966952923 3:184840408-184840430 TAGATTTTTGTGGCCGGGCATGG + Intronic
966963633 3:184967545-184967567 TAAATTGTGGTGGCCAGGCATGG + Intronic
967224686 3:187279806-187279828 CATTTTTAGATGGCCAGGGAGGG - Intronic
967469875 3:189849121-189849143 TAGAGGTTGAAGCCCAGGGAGGG + Intronic
968716777 4:2166065-2166087 TAGACTTTAATGGCCATGTATGG - Intronic
970511181 4:16783313-16783335 TAGATGTTTATGGTCAGGAAGGG + Intronic
971013245 4:22462267-22462289 TAAATATAGAAGGCCAGGGAAGG - Intronic
971300949 4:25442057-25442079 TACATTCTAATGGCGAGGGAAGG + Intergenic
971439601 4:26666688-26666710 CAGATGCTGATGGCCAGGAAAGG - Intronic
971582549 4:28361187-28361209 AAGTTTCTGATGGCAAGGGAAGG + Intergenic
971966860 4:33570385-33570407 AAAATTTTGAGGGCCAGGTACGG + Intergenic
972099282 4:35392406-35392428 AAGATTTTTTTGGCCAGGCATGG - Intergenic
973812110 4:54581568-54581590 TAGCCTTTCATGGCCAGGCACGG + Intergenic
977508109 4:97928188-97928210 TTAATTTTTATGGCCAAGGAGGG - Intronic
981144354 4:141307692-141307714 TAGAATTTGATGAGCAGTGAAGG + Intergenic
982991504 4:162282088-162282110 TATATTTTGTTGGCCAGGCACGG - Intergenic
983357549 4:166682874-166682896 TAGACTCTGATTTCCAGGGAAGG + Intergenic
983625370 4:169796853-169796875 TGCATTTTGATGGCTGGGGAAGG + Intergenic
983923836 4:173374569-173374591 AACATTTTGAGGGCCAGGCACGG - Intronic
984023163 4:174510949-174510971 TAGATTTTGATGCTCTGGAAGGG + Intronic
984524927 4:180847315-180847337 TATTTTTTAATGGCCAGGGATGG - Intergenic
984552472 4:181177071-181177093 TGAATTTTGATGGCCGGGCATGG - Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985115560 4:186586551-186586573 GAGATTGTGATGGGAAGGGACGG - Intergenic
985167760 4:187115684-187115706 TTAAATGTGATGGCCAGGGATGG + Intergenic
985689938 5:1302042-1302064 AAAATTTTAATGGCCAGGCACGG - Intergenic
985755965 5:1717318-1717340 TAAAAGTTGATGGCCAGGCACGG + Intergenic
986060738 5:4187915-4187937 GCGATTTCCATGGCCAGGGAGGG + Intergenic
986229753 5:5852553-5852575 TTCATATGGATGGCCAGGGAAGG + Intergenic
987673889 5:21049617-21049639 AAGATTTTTTTGGCCAGGCACGG + Intergenic
988456388 5:31390684-31390706 TAGATCTCGATACCCAGGGAGGG - Intergenic
989009933 5:36858460-36858482 AAGATTGTGATAGCCTGGGATGG - Intergenic
991082509 5:62616236-62616258 TAAATGTTGATGGGCAGGGTGGG + Intronic
992025108 5:72662478-72662500 TAGAATATGTTGGCCAGGGAAGG - Intergenic
994715246 5:103313865-103313887 CAGATTTAGATTGCAAGGGAGGG - Intergenic
994974823 5:106788588-106788610 TATATTCTGAAGGCCAGGCATGG - Intergenic
995439748 5:112177043-112177065 TAGAAGTTGCTGGCCGGGGACGG - Intronic
997370325 5:133355755-133355777 TAGGTTTTAATGGCCAAGAAGGG + Intronic
998123024 5:139594840-139594862 TAGATTTTGGTATCCATGGAAGG - Intronic
998157272 5:139794149-139794171 TAGGGTTTGATGGGCAGTGAAGG + Intergenic
998250809 5:140550968-140550990 GAGATTTTGATTGACTGGGAGGG - Intronic
1000633111 5:163613601-163613623 AAGATTTGGATGGTCAGGGAAGG - Intergenic
1001619333 5:173069610-173069632 TTGAATTTCATGGCCAGGCATGG - Intronic
1001904983 5:175464545-175464567 TTGATTTTGGTGGACAGGTAGGG - Intergenic
1004390035 6:15202330-15202352 TAAATTTTGTTGGCCAAGCATGG - Intergenic
1004946946 6:20625956-20625978 TAGAATTTAATGGCTGGGGATGG - Intronic
1005452219 6:25984586-25984608 TAAAAATTGATGGCCAGGCATGG + Exonic
1006077854 6:31545815-31545837 TAGAGTTTTATGGTCATGGATGG - Intronic
1006478775 6:34274911-34274933 TAGAGTTTGGTGGCCAGAGTGGG + Intergenic
1008019736 6:46562475-46562497 TACATTTTAAAGGCCAGGCATGG + Intronic
1009363404 6:62839988-62840010 TTGTTTTTAATGGCCAGGGGAGG + Intergenic
1010406214 6:75508865-75508887 TAGATTTTAATAGCCAGATAGGG + Intergenic
1010522666 6:76859855-76859877 TACTTATTGATGGTCAGGGAAGG - Intergenic
1011559509 6:88600454-88600476 TTGATTTTGATTGCCAAAGAAGG - Intergenic
1011618136 6:89216673-89216695 TAAATTGGGAGGGCCAGGGACGG - Intronic
1012368502 6:98472888-98472910 TAGAATTTCAAGGCCAGGCATGG + Intergenic
1012882956 6:104813508-104813530 TTTATTTTCATGACCAGGGAAGG + Intronic
1013941745 6:115672155-115672177 TAGATGTAGATGGTCAAGGAAGG + Intergenic
1014443985 6:121505318-121505340 TTGATTTTTAAGGCCAGAGAAGG - Intergenic
1014705425 6:124740547-124740569 TAGATCTGGAAGGGCAGGGATGG + Intronic
1016883703 6:148936983-148937005 TTGTTTCTGATGGCCAGGCATGG - Intronic
1018152651 6:160954937-160954959 TAGATTTTGTAAGCCAGGCACGG + Intergenic
1018500536 6:164406094-164406116 TAGCATTTGATGGCCAAGGTAGG + Intergenic
1018593605 6:165454357-165454379 TGAATTTTGGTGGCCAGGGGTGG + Intronic
1018792826 6:167162527-167162549 TAGATTTTGAAGGAAAGGGGAGG + Intronic
1021492690 7:21236633-21236655 TGGATTTTGATGTCCAAGGGAGG + Intergenic
1021860217 7:24898549-24898571 TGGATTGTGAAGGCCATGGATGG - Intronic
1022867737 7:34439695-34439717 TAGATTTGAATGGCCAGGTGTGG + Intergenic
1024011090 7:45267361-45267383 TTGATCTTGATCCCCAGGGAAGG - Intergenic
1024299397 7:47875425-47875447 AAGATTCTGATGTGCAGGGAAGG - Intronic
1024622876 7:51177852-51177874 TAGTTTTTGTTGGCCGGGCACGG + Intronic
1024636803 7:51297681-51297703 AAGATTTTCAAGGCCAGGCATGG - Intronic
1025091741 7:56069872-56069894 TGGATTTTCAAGGCCAGGCATGG - Intronic
1025150552 7:56543192-56543214 TAGATTTGGGAGGCCAAGGAGGG - Intergenic
1025163406 7:56686839-56686861 AAGATTTTGCTGGCCAGGTGCGG + Intergenic
1026692589 7:72562305-72562327 TATATTTTTTTGGCCAGGCATGG + Intronic
1028501704 7:91526635-91526657 TAGATTTTAATGGCCCTTGAGGG - Intergenic
1028660278 7:93264058-93264080 TGGATTTTGATGTCTATGGAGGG + Intronic
1028903191 7:96123829-96123851 TTGATTTTGGGGGCCAGGGTTGG + Intronic
1029197398 7:98815112-98815134 AAGATATGGATGGCCAGGCACGG + Intergenic
1029612487 7:101634548-101634570 TAGCTGTGGATGGCCAGGCACGG + Intergenic
1029730754 7:102436377-102436399 GAGGTCTTGTTGGCCAGGGAAGG + Intronic
1031193501 7:118585370-118585392 GAGATTTCGAGGGCCAAGGATGG - Intergenic
1031404845 7:121372580-121372602 GAGATTGCGAGGGCCAGGGAGGG + Intronic
1031943931 7:127818699-127818721 TAGAATTTGATGCACAGGGTGGG + Intronic
1033358113 7:140617301-140617323 TTGATATTGAAGGCCATGGAGGG - Intronic
1033843603 7:145404420-145404442 GAGATTTAGGGGGCCAGGGATGG + Intergenic
1034050943 7:147983911-147983933 TGGATTTTGAGGGCCTGGAAGGG + Intronic
1035955416 8:4072298-4072320 TACATTTTGAAGGCAAAGGAAGG - Intronic
1037405786 8:18541058-18541080 TAGATTTTGATGGCCAGGGAAGG - Intronic
1037544362 8:19903699-19903721 CAGTTTTTGTTGGCCAGGCATGG - Intronic
1038412878 8:27371836-27371858 TAGATTCTGTTGGCCAGGCATGG - Intronic
1038658280 8:29474210-29474232 CAGGCCTTGATGGCCAGGGATGG + Intergenic
1039340175 8:36639657-36639679 TGTATTTTGAGGGCCAGGCATGG + Intergenic
1039355668 8:36812508-36812530 TAAATGTTGATGGACAGGTAAGG + Intronic
1040588361 8:48765479-48765501 TATATTTTAATAGCCAGGCATGG - Intergenic
1040724222 8:50362141-50362163 TGGATTTTGTAAGCCAGGGAAGG + Intronic
1042438764 8:68799889-68799911 AATATTTTGAAGGGCAGGGATGG + Intronic
1042887039 8:73563791-73563813 TTTATTTTGATGGCCAGGCATGG - Intronic
1043361969 8:79483544-79483566 AAGAATTTGATGGCAAGGCAGGG - Intergenic
1043399848 8:79873089-79873111 AAGATTATGAAGGCCAGGCACGG - Intergenic
1043477908 8:80622855-80622877 TACATTCTGAAGGCCAGGCAAGG + Intergenic
1043562854 8:81515030-81515052 TAGATATTGAAGGCTGGGGAAGG - Intergenic
1044773321 8:95660784-95660806 CAGATTTACATGGCCTGGGAGGG + Intergenic
1045374004 8:101553146-101553168 TTGCTTTTGATGATCAGGGAAGG + Intronic
1046757132 8:117983594-117983616 TTGTTGTTGAAGGCCAGGGAGGG - Intronic
1048285723 8:133139945-133139967 TGGCTTTGGATGGCCTGGGAGGG - Intergenic
1048562771 8:135559649-135559671 TATATTTTGTTGGCCGGGCATGG - Intronic
1049406638 8:142454549-142454571 TGGATGTTCATGTCCAGGGATGG + Intronic
1049595065 8:143479553-143479575 TGGATAATGAAGGCCAGGGAGGG + Intronic
1050594178 9:7189217-7189239 TAGATATTCTTGGCCAGGTACGG + Intergenic
1050787237 9:9419982-9420004 TAAATTTTGATGGTAAGGAAAGG + Intronic
1051507371 9:17841523-17841545 AAAATTTTGTTGGCCAGGCATGG + Intergenic
1051777786 9:20655341-20655363 TAGCTTTTGATTGCTAGTGAGGG + Intergenic
1052257412 9:26474581-26474603 TAGTTTTTGTTGGCCAAGGTGGG - Intergenic
1052460017 9:28750972-28750994 AAGAGGTTGAGGGCCAGGGATGG + Intergenic
1053249352 9:36561435-36561457 AAGATGTTCATGGCCAGGCACGG - Intergenic
1053648531 9:40140227-40140249 GAGATTTGAAGGGCCAGGGATGG - Intergenic
1053667898 9:40329247-40329269 TAGATTTTGAAGGCAAGGCAAGG - Intergenic
1053757212 9:41323617-41323639 GAGATTTGAAGGGCCAGGGATGG + Intergenic
1053917704 9:42955534-42955556 TAGATTTTGAAGGCAAGGCGAGG - Intergenic
1054379043 9:64469286-64469308 TAGATTTTGAAGGCAAGGCAAGG - Intergenic
1054516713 9:66047036-66047058 TAGATTTTGAAGGCAAGGCAAGG + Intergenic
1054536052 9:66235943-66235965 GAGATTTGAAGGGCCAGGGATGG + Intergenic
1054792676 9:69270596-69270618 TATATTAAGATGGCCGGGGACGG + Intergenic
1054969933 9:71073517-71073539 TTAATTTTGCTGGCCAGAGATGG + Intronic
1055173277 9:73286822-73286844 GAGAAGTTGATGGTCAGGGAGGG + Intergenic
1055497617 9:76871415-76871437 CAGATTTTGGTATCCAGGGAGGG + Intronic
1055544082 9:77348658-77348680 TAGATTAAGGTGGCAAGGGAAGG - Intronic
1056254576 9:84785839-84785861 TAAATTTTGAGAGTCAGGGATGG + Intronic
1056515357 9:87344470-87344492 TAGATTTGGATGGGCTGAGAGGG - Intergenic
1056680087 9:88709544-88709566 AAAATTTAGATGGCCAGGCATGG + Intergenic
1056833601 9:89935916-89935938 TAGATACTGATGCCCAGGGATGG - Intergenic
1057552292 9:96060883-96060905 CACATGTTGATGCCCAGGGAAGG - Intergenic
1057553646 9:96070620-96070642 GAAATTTTGAGGGCCAGGCACGG + Intergenic
1061185790 9:129052484-129052506 TAAATTTTTGTGGCCAGGCACGG + Intronic
1061700013 9:132408909-132408931 TAGATTTTGAAGGGAAGGGGAGG - Intergenic
1061724890 9:132576795-132576817 CAGATTTAGAAGTCCAGGGAAGG + Intergenic
1062092635 9:134686540-134686562 AAGAATTTGATGGCCAGGCGCGG - Intronic
1202796293 9_KI270719v1_random:123524-123546 GAGATTTGAAGGGCCAGGGATGG - Intergenic
1185969480 X:4646396-4646418 TAGAATTTCATGGACAGGGAAGG - Intergenic
1187423267 X:19154999-19155021 GAGATATTGAAGGCCAGGCATGG + Intergenic
1187498442 X:19816515-19816537 TAGATTGTGTTGGCCAGGTGTGG + Intronic
1189453627 X:41163459-41163481 AAAATTTTGATGGTCAGGCACGG + Intronic
1189797612 X:44660475-44660497 TATATTTTCCTGGCCAGGCACGG + Intergenic
1190011006 X:46784716-46784738 TAGAAATAGATGGCCAGGCATGG + Intergenic
1193214212 X:78843447-78843469 TAAATTTTTTTGGCCAGGCATGG + Intergenic
1194374571 X:93115953-93115975 TAGATTTTTATGCCTAGAGATGG + Intergenic
1194415207 X:93603561-93603583 TAAATTTAGGTGGCCAGGCATGG + Intergenic
1194866330 X:99073057-99073079 TAGATTTTGTGGGCCATGTATGG + Intergenic
1195610031 X:106855878-106855900 TTGAATTTGTTGGCCAGGCATGG + Intronic
1195976658 X:110534586-110534608 TAGAATTTGGAGGCCAGGCATGG + Intergenic
1197645435 X:129011920-129011942 TAGAATTTCCTGGTCAGGGATGG - Intergenic
1197709811 X:129657529-129657551 TACATTTTGAAGGCTAGGTAGGG - Intergenic
1197848859 X:130834989-130835011 TATATTTTGATTGGCAGGGATGG - Intronic
1198849754 X:140953622-140953644 TAGAAATTGTTGGCCAGGCATGG - Intergenic
1200682593 Y:6230011-6230033 TAGATTTTTATGCCTAGAGATGG + Intergenic
1201731081 Y:17203945-17203967 TAGATTATAATTGTCAGGGATGG + Intergenic
1202037830 Y:20652954-20652976 AATATTTTTATGGCCAGGCATGG + Intergenic