ID: 1037408429

View in Genome Browser
Species Human (GRCh38)
Location 8:18568431-18568453
Sequence AGGAGTCTAAGAAGCAAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037408422_1037408429 21 Left 1037408422 8:18568387-18568409 CCACTGCAGGAATTGGAGACAGA 0: 1
1: 0
2: 0
3: 18
4: 236
Right 1037408429 8:18568431-18568453 AGGAGTCTAAGAAGCAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037408429 Original CRISPR AGGAGTCTAAGAAGCAAGGG GGG Intronic
No off target data available for this crispr