ID: 1037411228

View in Genome Browser
Species Human (GRCh38)
Location 8:18599828-18599850
Sequence TTGTGTGCATGGAGGGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037411223_1037411228 -8 Left 1037411223 8:18599813-18599835 CCTGGAGCCAATCTGTTGTGTGC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037411228 Original CRISPR TTGTGTGCATGGAGGGATGA CGG Intronic
No off target data available for this crispr