ID: 1037412795

View in Genome Browser
Species Human (GRCh38)
Location 8:18616123-18616145
Sequence CTGGCTTACCACTCACGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037412789_1037412795 4 Left 1037412789 8:18616096-18616118 CCTGGCCCTCATTACAGGGCGAG 0: 1
1: 0
2: 1
3: 9
4: 73
Right 1037412795 8:18616123-18616145 CTGGCTTACCACTCACGCGCAGG No data
1037412793_1037412795 -2 Left 1037412793 8:18616102-18616124 CCTCATTACAGGGCGAGGGCTCT 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1037412795 8:18616123-18616145 CTGGCTTACCACTCACGCGCAGG No data
1037412786_1037412795 20 Left 1037412786 8:18616080-18616102 CCTACTGATAGGTGTTCCTGGCC 0: 1
1: 0
2: 0
3: 11
4: 77
Right 1037412795 8:18616123-18616145 CTGGCTTACCACTCACGCGCAGG No data
1037412792_1037412795 -1 Left 1037412792 8:18616101-18616123 CCCTCATTACAGGGCGAGGGCTC 0: 1
1: 0
2: 0
3: 1
4: 68
Right 1037412795 8:18616123-18616145 CTGGCTTACCACTCACGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037412795 Original CRISPR CTGGCTTACCACTCACGCGC AGG Intronic
No off target data available for this crispr