ID: 1037415012

View in Genome Browser
Species Human (GRCh38)
Location 8:18640518-18640540
Sequence GAGAGCCAAGTGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 349}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037415012_1037415016 10 Left 1037415012 8:18640518-18640540 CCCTTCACCTTCACTTGGCTCTC 0: 1
1: 0
2: 2
3: 24
4: 349
Right 1037415016 8:18640551-18640573 TTCCTGCCACCATGTGAAGAAGG 0: 190
1: 1080
2: 1867
3: 2451
4: 2170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037415012 Original CRISPR GAGAGCCAAGTGAAGGTGAA GGG (reversed) Intronic
901774494 1:11550794-11550816 GAGAGCGAGGAGAAGGTGAAGGG + Intergenic
902204997 1:14861896-14861918 GGGAGCCAAGTAATGCTGAAAGG + Intronic
902385100 1:16071913-16071935 GGTGGCCAAGTGAAGGGGAAGGG + Intronic
905083825 1:35351075-35351097 GAATGCCAAGTGGAGGTGACTGG + Intronic
906287038 1:44594326-44594348 CAGTCCCAAGTGCAGGTGAAGGG - Intronic
906410364 1:45573962-45573984 GAGTACAAACTGAAGGTGAATGG + Intergenic
906894562 1:49757150-49757172 GAGAGAGAAGTGAGAGTGAAGGG - Intronic
907696529 1:56735703-56735725 GAGAGAGAAGAGAAAGTGAAGGG - Intronic
909658938 1:78061294-78061316 GGAAGCCAATTGAAGGTGGACGG + Intronic
910060903 1:83090416-83090438 TAAAGCCAAGCCAAGGTGAAAGG + Intergenic
910331966 1:86083739-86083761 GAGAAGCAAGCCAAGGTGAAGGG + Intronic
910969056 1:92836223-92836245 GAAGGCCAAGTGGAGGTGACTGG + Exonic
911186306 1:94908383-94908405 GAGAGCCAAGGGAAGCTCTAAGG - Intronic
911552128 1:99295789-99295811 GCTTGACAAGTGAAGGTGAAAGG + Intronic
913973559 1:143435684-143435706 GAGAGCCAAGTGAAGCAAATAGG + Intergenic
914067947 1:144261291-144261313 GAGAGCCAAGTGAAGCAAATAGG + Intergenic
914111208 1:144705063-144705085 GAGAGCCAAGTGAAGCAAATAGG - Intergenic
916156913 1:161860353-161860375 GAGAACAAATTTAAGGTGAAAGG - Intronic
916462897 1:165045434-165045456 GAGACCCAAGAGAAGGTGAGTGG + Intergenic
916463584 1:165050058-165050080 GAGAGCCAAGTGGTGGGGTAAGG - Intergenic
916991423 1:170249681-170249703 GAGAACCAGGTGGAAGTGAACGG - Intergenic
917309937 1:173668493-173668515 CAGAGCCAAGGGAAGGCAAAGGG + Intronic
920938534 1:210458630-210458652 GTGAGCAAAGAGAAAGTGAAGGG + Intronic
921361099 1:214331872-214331894 GAAAGCCAAGCAAAAGTGAAAGG - Intronic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
921795129 1:219334076-219334098 GAGCTACAAGGGAAGGTGAAGGG - Intergenic
922464461 1:225837452-225837474 CATAGCCAAGGGCAGGTGAATGG - Intronic
923224360 1:231925415-231925437 GAGAGTCAAGTGCAGCTGAATGG + Intronic
1064173994 10:13058298-13058320 GAAGGCCAAGTGAAGGTGACTGG - Intronic
1064536353 10:16361368-16361390 GAGGGCCAGGTAAAGATGAAGGG + Intergenic
1065169295 10:23010807-23010829 GAGAGGCAAGGGAAGGAGCAGGG - Intronic
1066349890 10:34627573-34627595 GAAGGCCAGGTGAAGGTGCAGGG + Intronic
1066387624 10:34954533-34954555 GGGAGCCAAGTGAGGAGGAAAGG + Intergenic
1069591560 10:69645221-69645243 GAGAGCGCAGGAAAGGTGAAGGG - Intergenic
1069679007 10:70270487-70270509 GAGGGCCAAGTGAAGGATAGTGG - Intronic
1070331853 10:75423165-75423187 GAGAGCCAAGTGAACTTCTAGGG - Intergenic
1070787076 10:79168122-79168144 TACAGCCAAGTGCAGCTGAAGGG - Intronic
1070848292 10:79541750-79541772 GAGAGAACAGTGCAGGTGAAAGG + Intergenic
1070925488 10:80218419-80218441 GAGAGAACAGTGCAGGTGAAAGG - Intergenic
1071169211 10:82843800-82843822 GAGATGCAAGGGAAGGTTAATGG + Intronic
1072167329 10:92826809-92826831 GTGAGCCAAGTGAATATCAAAGG + Intergenic
1072309568 10:94141498-94141520 GAAGGCGAAGGGAAGGTGAAGGG + Intronic
1072309574 10:94141520-94141542 GAAGGCTAAGGGAAGGTGAAGGG + Intronic
1072309580 10:94141542-94141564 GAAGGCTAAGGGAAGGTGAAGGG + Intronic
1072309586 10:94141564-94141586 GAAGGCTAAGGGAAGGTGAAGGG + Intronic
1073012397 10:100371588-100371610 GAGAGGAAAGTGGAAGTGAAAGG + Intergenic
1073015212 10:100393533-100393555 GAAAGCCAAGCGAAAGTAAAAGG - Intergenic
1074425492 10:113347662-113347684 GAGAGCCAAACGGAGCTGAAGGG - Intergenic
1074773667 10:116750257-116750279 GAAGGCCAAGTGGAGGTGACTGG + Intergenic
1075564275 10:123492372-123492394 GAGAGACAAGAGGAGGAGAAGGG + Intergenic
1079960175 11:26914109-26914131 AAAAGCCATGTGAAGGTGCAGGG + Intergenic
1081803149 11:45873361-45873383 AAGAGCCCAGGAAAGGTGAAGGG - Intronic
1083404718 11:62448688-62448710 GACATCCAAGTGAAGAAGAAAGG + Intronic
1084696209 11:70757038-70757060 GGGAGCCGTGTGAAGGTCAAAGG + Intronic
1085911252 11:80829501-80829523 GAGAACCAAGTGATGTGGAAAGG - Intergenic
1086407689 11:86512797-86512819 GAGAGCAAGGTCCAGGTGAAGGG + Intronic
1086510528 11:87552987-87553009 GAAAGACAAGTGAAGATGAAAGG - Intergenic
1087686504 11:101271886-101271908 GAGAGCCAAGTGAAGGTCCACGG + Intergenic
1088258001 11:107918928-107918950 GCAAGCCATGTGAAGATGAAGGG + Intronic
1089112148 11:116065414-116065436 GAGAGCTCAGTGAAGATGGATGG - Intergenic
1090118526 11:124000442-124000464 GGGAGGCACGTGGAGGTGAAGGG + Intergenic
1091657191 12:2354236-2354258 GAGAGCCAGGTGAGGGTGCGAGG - Intronic
1091661182 12:2384978-2385000 GGGAGCCAACTGACCGTGAAAGG + Intronic
1093429016 12:19063233-19063255 AACAGCCAAGGGAAGATGAAGGG + Intergenic
1093835021 12:23818495-23818517 GAGTGGCAGGTGAATGTGAAGGG + Intronic
1094361131 12:29632484-29632506 GAGTGCCCAGTGAAGGGGAAGGG - Intronic
1095408260 12:41891892-41891914 GAGATACTAGTGAAGGTAAAAGG + Intergenic
1096518219 12:52170076-52170098 GAGAGCCAAGAGGAGGAGATAGG + Exonic
1096647925 12:53048292-53048314 GTGAGACCAGTGAAGGTGAGAGG + Intronic
1097161509 12:57049450-57049472 GAAAGCCAAGTGAAGGGAGAAGG - Intronic
1097464787 12:59908703-59908725 GAGACCCATGTGGAGGTGGAAGG + Intergenic
1098255222 12:68609964-68609986 GAGAGCAAAGTGCAGGGAAAAGG - Intergenic
1100002703 12:89856755-89856777 GAAAGCCAAGCTAAGATGAAAGG + Intergenic
1100838982 12:98593387-98593409 GAGAGACACCTGAAGGTGAAGGG + Intergenic
1100883534 12:99044500-99044522 GAGAGTCCAGGGCAGGTGAATGG + Intronic
1101241883 12:102847141-102847163 AAGGGCCAAGTGAGGGTGGAAGG - Intronic
1101472067 12:105007104-105007126 TAGAGCAAAGGGAAAGTGAAGGG - Intronic
1102043971 12:109818156-109818178 GGGTGCCAGGTGAGGGTGAAGGG + Intronic
1102406580 12:112679109-112679131 GGAAGCCATGTGAAGGTGAGAGG + Intronic
1102552507 12:113702094-113702116 GAGAGAAAAGGGAAGGAGAAAGG - Intergenic
1102588290 12:113938751-113938773 AAAAGCCAAGTGAGGATGAAGGG + Intronic
1102922998 12:116807004-116807026 GAGATCTAAGTGAAAGTGACGGG - Intronic
1105593007 13:21811699-21811721 GAGAGCCAAGTGATAGAGAGGGG + Intergenic
1107948966 13:45445005-45445027 GAGAAAGAAGTGAAGGGGAAAGG + Intergenic
1108076650 13:46686850-46686872 GTGAGCCAAGTGCTGGTGAATGG - Intronic
1108086161 13:46796060-46796082 TAGAGCCATGTGAAGGTGTTTGG - Intronic
1109778315 13:67073246-67073268 CAGAGCAAAGCTAAGGTGAATGG + Intronic
1111978661 13:94994236-94994258 GAGAGGCCAGGGAAGTTGAATGG + Intergenic
1112622210 13:101064591-101064613 GAATGCCATGTGAAGATGAAGGG + Intronic
1112756217 13:102637100-102637122 CAGAGCTAAATGAAGCTGAAGGG - Exonic
1113368191 13:109697913-109697935 AAGATCCAAGTGAAGGAAAATGG + Intergenic
1113422985 13:110184397-110184419 GAGACCCAAGGGAAAGTGATCGG + Intronic
1113516665 13:110908079-110908101 AAGAGCCAGGTGAAGGTGCCCGG + Intronic
1113552088 13:111200375-111200397 GAGAGAAAGGTGAAGGTGAGTGG - Intronic
1115117067 14:29894143-29894165 GTGAGCCAAGTGAAGTGGATGGG + Intronic
1116122588 14:40739272-40739294 GAGAGAGAAGGGAAAGTGAAAGG + Intergenic
1120818719 14:88891926-88891948 CTGAGCCCAGTGAAGGGGAAAGG - Intergenic
1121185572 14:91964843-91964865 GAGAGGCAAGTGGGGGTGGAAGG - Intergenic
1121242492 14:92440562-92440584 GGGAGCCTATGGAAGGTGAAAGG + Intronic
1121542923 14:94741977-94741999 GAGAGGAAAATGAAGGAGAAAGG - Intergenic
1121791598 14:96703439-96703461 GAGAGCCAAGCAAAGGTCATGGG - Intergenic
1121901629 14:97698162-97698184 GAGAGCACTGTGAAGGTGACTGG - Intergenic
1122126424 14:99581004-99581026 GAGAGCCAAGTGCAGGGTAGGGG + Intronic
1122523717 14:102364499-102364521 GAGAACTAAGTGCAGGTGTAGGG + Intronic
1122915368 14:104855901-104855923 GAGACCCAAGTGCAGCTGAGGGG - Intergenic
1123067764 14:105626993-105627015 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123071783 14:105645718-105645740 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123091447 14:105743994-105744016 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123097217 14:105772335-105772357 GAGGGCCAAGGGCAGGTGCAAGG - Intergenic
1123904626 15:24909443-24909465 GAAGGCCAAGTGGAGGTGACTGG - Intronic
1123926003 15:25111533-25111555 GAGAGCCTAGTCATGATGAATGG + Intergenic
1124226060 15:27896049-27896071 GAAGGCCAAGTGGAGGTGACTGG + Intronic
1124448489 15:29762626-29762648 GAAAGCCAAGGGAAAGTGTATGG + Intronic
1126663664 15:51056087-51056109 GAGAGCCAGCTGAGGCTGAATGG + Intergenic
1128398483 15:67253448-67253470 GAGAGAAAAGAGAAAGTGAAGGG + Intronic
1129854577 15:78814112-78814134 GCCAGTCATGTGAAGGTGAAAGG + Intronic
1130366754 15:83247784-83247806 TTGAGCCAAGTTAAGGAGAATGG - Intergenic
1131093585 15:89641961-89641983 GAGAGCAACGAGAGGGTGAAGGG - Intronic
1133317290 16:4892623-4892645 GAGAGCCAAGTCAGGGCGAGAGG - Intronic
1133605671 16:7385402-7385424 GAAAACCCAGTGGAGGTGAAGGG + Intronic
1137247967 16:46720847-46720869 GAGAGGAGAGTGATGGTGAAGGG - Intronic
1137449812 16:48561148-48561170 GAGAGGCAACAGAAGGTGAAAGG + Exonic
1137840997 16:51640755-51640777 GAGCGCCAAATGCAGGTGATAGG + Intergenic
1138531583 16:57637420-57637442 GAGTGCCAAGTGTATGTAAAAGG + Intronic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1139299447 16:65932875-65932897 GAGAGCCTGGGGAAGGGGAAAGG - Intergenic
1139776437 16:69319704-69319726 CAAAGACAAGTGAAGGTGGAAGG + Intronic
1140862034 16:79026328-79026350 GATAACCTAATGAAGGTGAAGGG - Intronic
1141220521 16:82065293-82065315 GAGAGCTAAGAGAGGGGGAAAGG - Intronic
1142062980 16:88042565-88042587 GAGAGGGAAGAGAAGGTGAAGGG + Intronic
1142694429 17:1625803-1625825 TAAACCAAAGTGAAGGTGAAGGG - Intronic
1142930129 17:3277260-3277282 GAGAAGAAAATGAAGGTGAAAGG + Intergenic
1145990371 17:29075713-29075735 GAAAGAAAAGAGAAGGTGAATGG - Exonic
1146217112 17:30986164-30986186 GAGAGTCCAGTGAAGGAAAAGGG - Intronic
1146903912 17:36605882-36605904 GAGAGCCAAGAGCAGAAGAAAGG - Intronic
1148262006 17:46192760-46192782 GAGAGCGAGGAGAAGGAGAAAGG + Exonic
1148460693 17:47837632-47837654 GAGAGCCAAGTGAGGCCCAAAGG - Exonic
1149039207 17:52167635-52167657 GAGTGCCAAGTGTAGATCAATGG + Intergenic
1151227227 17:72656301-72656323 GAGAGGGAAGTGGAGATGAAGGG + Intronic
1151398564 17:73841126-73841148 GAGATCCTGGTGAGGGTGAAAGG + Intergenic
1151589960 17:75036709-75036731 GACAGCCAAGTGAAAGCGCAGGG - Intronic
1151791321 17:76307679-76307701 GAGAGCCAAGTGAAGGACCTGGG - Exonic
1152004729 17:77673067-77673089 GAGGGCCAAGGGCATGTGAAGGG - Intergenic
1152316812 17:79585808-79585830 GAGAGACAAGAGAAAGTGAAAGG + Intergenic
1153069587 18:1089748-1089770 GAGAGCCAAGTGAAATAGAGTGG - Intergenic
1154166112 18:12015581-12015603 GAGAGCCCAGAGCAGGGGAAGGG + Intronic
1155381335 18:25225689-25225711 CACAGCCAAGTGGAGCTGAATGG + Exonic
1156384108 18:36590826-36590848 GAGAGCCACATGTAGGAGAATGG + Intronic
1156465828 18:37347426-37347448 GAGAGCCAAGTGTAGGGGTGGGG - Intronic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156690168 18:39697799-39697821 TAGAACCAAGAGAAGGAGAAGGG - Intergenic
1158231423 18:55259964-55259986 GAGAGCCAACAGGAGTTGAAGGG + Exonic
1158425771 18:57338578-57338600 GAGAGAGAAGGGAAGGTGGAGGG - Intergenic
1158866878 18:61646491-61646513 GCTAGCCCAGTGAAGGTGGAGGG + Intergenic
1159203742 18:65223400-65223422 GAGAGCCAAGTGGCAGGGAAGGG - Intergenic
1161558092 19:4955667-4955689 GAGACACAAGTGAAGGTCTAGGG - Intronic
1162788806 19:13052541-13052563 GAGGGCCATGTCAGGGTGAAGGG + Intronic
1163879529 19:19905168-19905190 GAGAGCACAATGTAGGTGAAAGG - Intronic
1164151685 19:22559058-22559080 AAGAGCCAAGAGGAGGTTAATGG + Intergenic
1164214006 19:23128026-23128048 GAAGGCCAAGTGGAGGTGACTGG + Intronic
1165913515 19:39244226-39244248 GAGGAACAAGTGAAGGTGACAGG + Intronic
1165917445 19:39269398-39269420 GAGGAACAAGTGAAGGTGACAGG - Intronic
1166293410 19:41877564-41877586 GGGAGCCCAGCGAAGGAGAAGGG + Intronic
1166348000 19:42178419-42178441 GAGAGACAAATGAAGATGTAAGG + Intronic
1166348736 19:42183670-42183692 GGGAGCCAAGAGGAGGTGGATGG + Intronic
1167415548 19:49369536-49369558 GAGAACCAGGAGAAGGGGAAGGG + Intronic
925163664 2:1703460-1703482 GAGAGACAACTCCAGGTGAAGGG + Intronic
927447850 2:23181179-23181201 GAGAGAGAAGTGAAGGTGCCAGG - Intergenic
927849080 2:26487674-26487696 GAGAGCCAAGAGAAAGTCAGGGG - Intronic
928122920 2:28596752-28596774 GAGAACTGAGTGAAGGAGAAGGG + Intronic
928619336 2:33072596-33072618 GAGAAAAAAGTGCAGGTGAAAGG + Intronic
928767878 2:34670203-34670225 GAGTGCTAAGTAAAGTTGAAAGG + Intergenic
930309881 2:49726776-49726798 GAGAGAGAAGAGAAAGTGAAGGG - Intergenic
932043849 2:68327509-68327531 GAGAGCCAAATGAGTGGGAAGGG + Intergenic
933229531 2:79790285-79790307 GAGAAACCAGTGAAGGGGAAAGG + Intronic
934032990 2:88065069-88065091 GAAAGCGAAGTGAAGGGGAGGGG - Intergenic
934178253 2:89596650-89596672 GAGAGCCAAGTGAAGCAAATAGG + Intergenic
934288548 2:91670942-91670964 GAGAGCCAAGTGAAGCAAATAGG + Intergenic
936086233 2:109471372-109471394 GAGAGAGAAGAGAAAGTGAAGGG + Intronic
936262023 2:110968191-110968213 GAAGGCCAAGTGTAGGTGACTGG + Intronic
937417923 2:121731745-121731767 GTGAGCCAGGTGAAGGGGACAGG - Intronic
937829037 2:126399882-126399904 GAGAGCCAAGTGAAATTCAGGGG - Intergenic
937926324 2:127170454-127170476 GTGAGCCAGGTGAAGGGGACAGG + Intergenic
939123374 2:138145479-138145501 GGGAGGCAGGTGAAAGTGAAGGG + Intergenic
939284836 2:140115371-140115393 GAGAGTCAAGTTTAGTTGAAGGG + Intergenic
939553902 2:143650592-143650614 CAGAGCCAAATGAAGGAGACAGG + Intronic
939694656 2:145309695-145309717 GAGTGGTAAGTGAATGTGAAGGG - Intergenic
940161886 2:150722396-150722418 GAGAGCCAAGAGAACATCAAAGG - Intergenic
941219600 2:162759629-162759651 GAGGACCAAATGAAGGAGAAAGG + Intronic
942193368 2:173493295-173493317 GAGAGGGAAGCCAAGGTGAAGGG + Intergenic
942763887 2:179431186-179431208 AAGAGGCAAATGAAGGTAAAAGG + Intergenic
943604528 2:189961275-189961297 GAGGGCCAGGAGAAGGTGGAGGG + Intronic
944689583 2:202147465-202147487 AAGAGCCCAGTGGAGGGGAAGGG + Intronic
945201095 2:207282268-207282290 CAGAGCCAAGCAAAGGTCAATGG + Intergenic
945789083 2:214281083-214281105 GAAGGCCAAGTGGAGGTGACTGG - Intronic
946779413 2:223177588-223177610 GAGAGAGAAGTCAAGGAGAATGG + Intronic
947689346 2:232120504-232120526 CAGTGCCAAGTGCAGGTGACGGG + Intronic
948549945 2:238764623-238764645 CAGAGCCAAGTGAAGGAGGGAGG + Intergenic
1170613592 20:17932741-17932763 GAGAGACTAGTGCAGGTGTAGGG + Intergenic
1171493087 20:25535860-25535882 GGGAGCCAAGGGAAGGGAAAGGG + Intronic
1172032427 20:31991294-31991316 CAGAGCCATGGGAAGGGGAAGGG + Intronic
1172781545 20:37439610-37439632 GAGTGCCCAGGGATGGTGAAGGG - Intergenic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1173549790 20:43924609-43924631 GGGAGCTCAGTGATGGTGAAAGG - Intronic
1174198516 20:48790642-48790664 GAGAAGAAAGGGAAGGTGAAGGG + Intronic
1174677589 20:52373298-52373320 GAGAGCAATGTGAAGGAGACAGG - Intergenic
1174719646 20:52798233-52798255 GAGGACCAAGTGAAGGTGGTGGG - Intergenic
1175219357 20:57408127-57408149 GAGAGGCAGGAGAAGGTGCAAGG - Exonic
1178295924 21:31409848-31409870 GAGAGCTAGGTGAAGGGCAAAGG + Intronic
1178506828 21:33169474-33169496 GTGAGCCAAGAGCATGTGAAAGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186122 21:46140212-46140234 GTGAGGCACGTGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1182518008 22:30869947-30869969 GAGAGCAAAGTGAGGTTGACTGG + Intronic
1184174119 22:42776917-42776939 GACGGCCAAGTGGAGGTGACTGG - Intergenic
1184427894 22:44423818-44423840 CAAACCCAAGGGAAGGTGAACGG - Intergenic
1184902176 22:47453277-47453299 GGGAGCCGAGTGGAGGGGAAGGG + Intergenic
1184958999 22:47915186-47915208 GAGGGCCCAGCGTAGGTGAACGG + Intergenic
1185243315 22:49758604-49758626 GAAGGCCAAGTGGAGGTGACTGG - Intergenic
949561082 3:5203201-5203223 CAGAGCCCAGAGAAGATGAAAGG - Intronic
949850966 3:8419907-8419929 GAGAGTCAAAATAAGGTGAATGG - Intergenic
950757254 3:15185533-15185555 GAGAGGGAAGGGAAGGGGAAGGG + Intergenic
950848343 3:16036593-16036615 GAGAGCCAAGAGAATATGACCGG + Intergenic
951072922 3:18353132-18353154 GAGAGCAGAGTGCAGGTGAGAGG - Intronic
951219568 3:20055029-20055051 GTGAGCCAGGGGGAGGTGAAAGG + Intronic
951691115 3:25397235-25397257 GAGAGCCAAGTGAAACATAAAGG - Intronic
952125257 3:30292248-30292270 GAGAGGAAAGGAAAGGTGAAAGG - Intergenic
952440764 3:33326111-33326133 GAGAGCTAAGGGATGCTGAAGGG - Intronic
952555491 3:34525286-34525308 GAGAGCCAGGAGAAGATTAATGG - Intergenic
953822182 3:46216278-46216300 GAGTGCCAAGTGAATGAGCAAGG + Intronic
954834780 3:53456499-53456521 GAGAGCCCAGTGATGGAGAATGG + Intergenic
955401384 3:58594075-58594097 AAGAGCATAGAGAAGGTGAAAGG - Intronic
956534404 3:70259920-70259942 AAGTGCCAAGTGAAGGGGAAAGG + Intergenic
957846062 3:85737167-85737189 GTAAGACAAGTGAAAGTGAAGGG + Intronic
958737136 3:98022606-98022628 GACAGGCAAGAGAAGGTTAAGGG + Intronic
961994695 3:131229727-131229749 GAGAGGCAAGTGAAGGGTACAGG + Intronic
962345386 3:134614911-134614933 GTGAGCCAAGTGAGGGAAAAAGG + Intronic
963040282 3:141065248-141065270 GAGCTCCATGGGAAGGTGAATGG - Intronic
963821483 3:149899558-149899580 GAGAGAACACTGAAGGTGAAAGG + Intronic
964200281 3:154111456-154111478 CTGAGCCAGGTGAAGCTGAAAGG + Intergenic
964676471 3:159287773-159287795 GAGTGGCAAGTGAAGCTAAAAGG + Intronic
965549332 3:169948168-169948190 GTGTGCCAAGTGGAGGAGAAGGG + Intergenic
965678152 3:171221380-171221402 GTTAGCCAAGTGAAGGGGTAGGG - Intronic
965872075 3:173276039-173276061 GAGAGGTAAGTGAGGGAGAAGGG - Intergenic
966219497 3:177536220-177536242 GAGAGTCAAGTGAAGGTGGGAGG + Intergenic
967137090 3:186521741-186521763 GAGAGCCAAGTGAGGGGGCGTGG - Intergenic
967962733 3:194938928-194938950 AAGAGGCAAGAGAAGCTGAAGGG + Intergenic
969527174 4:7709787-7709809 GAGAGGCAGGTGAAAGTGACTGG - Intronic
970300142 4:14672574-14672596 AGGAGCCAAGTGATGGTGGAAGG - Intergenic
970558755 4:17261735-17261757 CAGAGCCAAGAAAAGGTGAGTGG + Intergenic
972142817 4:35982533-35982555 GAGAGGCAGGTGTAGGTGGATGG - Intronic
973090841 4:46134351-46134373 GATATCCCTGTGAAGGTGAAGGG + Intergenic
974381887 4:61151454-61151476 GAGAGGAAAGCGAAGGTAAAGGG - Intergenic
974950242 4:68577839-68577861 GAGAGATCAGTGAAGGAGAAGGG - Intronic
975242087 4:72071858-72071880 AAGAGAAAAATGAAGGTGAAGGG - Intronic
975311181 4:72905437-72905459 GAGACCCAAGTGAGGGAGCAAGG + Intergenic
976389609 4:84495664-84495686 GAGAGTCAGGTCAAGGTGAGTGG - Exonic
977516393 4:98025742-98025764 GAAGGCCAAGTGGAGGTGACTGG + Intronic
978072137 4:104487242-104487264 GAGAGCCAAGAGTGGGGGAAGGG + Intronic
978970984 4:114806698-114806720 AAGATCAAAGTGCAGGTGAATGG + Intergenic
980972261 4:139577784-139577806 AAGAGCCAGGGGAAAGTGAATGG + Intronic
981153726 4:141409364-141409386 GTGAGGCAAGCAAAGGTGAAAGG + Intergenic
982687626 4:158510096-158510118 TAAAGCCAAGTGAATGTGGATGG + Intronic
982866481 4:160519012-160519034 AAGAGAGAAGTGAAGGTGAGGGG - Intergenic
983927732 4:173419795-173419817 GAAGGCCAAGTGGAGGTGACTGG - Intergenic
985677048 5:1237578-1237600 GAGAGGCAAGTGGAGGTGGGTGG + Intronic
986491966 5:8302360-8302382 TAGAGCCAAGAGAAGATGGATGG - Intergenic
986572592 5:9181069-9181091 CAAAGCTAAGTGAAGGTGACAGG + Intronic
986786485 5:11118964-11118986 AAGAGCCAAGAGAGTGTGAAGGG - Intronic
987170410 5:15251167-15251189 GAGAGCCAAGTGCACTAGAAAGG - Intergenic
987648492 5:20708396-20708418 GGGAGCCCAGTGTTGGTGAACGG + Intergenic
988747841 5:34160519-34160541 GGGAGCCCAGTGTTGGTGAACGG - Intergenic
989149598 5:38285769-38285791 GAGAGAGAAGAGAAAGTGAAGGG + Intronic
990025297 5:51180363-51180385 GAGAACCATGTGAGGGTGATAGG + Intergenic
990756726 5:59079930-59079952 CAGAGGCAAGGGAAGGGGAAAGG + Intronic
991186755 5:63817659-63817681 AAGAGTCAGGTGAAGGAGAATGG - Intergenic
993247070 5:85464787-85464809 GAAGGCCAAGTGGAGGTGACTGG + Intergenic
994091114 5:95810434-95810456 GAATGCTAAGTGAAAGTGAAAGG + Intronic
995105931 5:108378600-108378622 TAGAGCCATGTGGTGGTGAAAGG - Intronic
995226204 5:109704198-109704220 GAGTGCCAAATGACTGTGAAGGG - Intronic
996118101 5:119641102-119641124 GAGAGACAACTGCAGGAGAAAGG - Intergenic
998224936 5:140319692-140319714 GAAAGGAAAGTGAGGGTGAATGG + Intergenic
998842886 5:146274934-146274956 GAGAGGGAAGAGCAGGTGAAAGG - Intronic
999588316 5:153116086-153116108 GAGAGGAAAGTGAAGGTGAAAGG - Intergenic
999623105 5:153491725-153491747 GAGAGCCAACAGGAGGAGAAAGG - Intronic
999932704 5:156451057-156451079 GAGAGGCAAGGGGAGGGGAAGGG - Intronic
1001954198 5:175837210-175837232 CAGAGCTAAGTGAAGGTCAGGGG - Intronic
1002533563 5:179863812-179863834 GAGAGCCAGGTGGTGGTGGAGGG - Exonic
1003119409 6:3307501-3307523 GAGGGACAAGTGAAGGCTAAAGG - Intronic
1003594204 6:7460085-7460107 GAGGGCCAGGTGAAGATGAGGGG + Intergenic
1004031469 6:11874231-11874253 GTGAGCCAGGTAAATGTGAAGGG + Intergenic
1005545424 6:26863603-26863625 GGGAGCCCAGTGTTGGTGAACGG - Intergenic
1005897622 6:30191540-30191562 GAGAGCAGAGTGAAGGGGGATGG + Intronic
1006218942 6:32471386-32471408 GAGAGCCATGTGAAGATCTAAGG - Intergenic
1006641258 6:35490965-35490987 GAGACCCAAGTGAGGGTCAAGGG + Intronic
1007157564 6:39760395-39760417 GAGAGCTTTGTGAAGGCGAAGGG + Intergenic
1008113895 6:47524620-47524642 GAGAGCCAAGTGAAGTACAGTGG - Intronic
1008247878 6:49201596-49201618 AAGAGTAAAGGGAAGGTGAAAGG - Intergenic
1008478342 6:51957791-51957813 GAGAGCGGAGAGGAGGTGAAGGG - Intronic
1008478402 6:51958452-51958474 GAGAGAAAAGTGTAGGAGAAAGG - Intronic
1009016129 6:57904371-57904393 GGGAGCCCAGTGTTGGTGAACGG - Intergenic
1009767376 6:68098016-68098038 GAGTGGTAAGTGAATGTGAAGGG - Intergenic
1009837785 6:69026512-69026534 GAGAGGGAAGTGAAGCTAAAAGG + Intronic
1011787741 6:90865687-90865709 GAGAGTGAAGAGAAAGTGAAAGG + Intergenic
1012443434 6:99284141-99284163 GAGAGTTGAGTGGAGGTGAAGGG - Intronic
1012649103 6:101730690-101730712 AAGAGACAAGTGAAAGTGGAAGG + Intronic
1013279397 6:108621736-108621758 GAGAGAAAATTGAAGGTGAGAGG + Intronic
1013432974 6:110072007-110072029 GAGAGCCAAGAGAATTTGAGTGG + Intergenic
1014645984 6:123973391-123973413 GAGAGGAAAGTGAAGCTCAAAGG + Intronic
1016276518 6:142359499-142359521 GTGAGCCAAGTAAAGGAGGAAGG - Intronic
1019137781 6:169922114-169922136 GAGAGCCCTGTGAAGGAGGAAGG + Intergenic
1019222112 6:170481081-170481103 CAGATCCAAGTAAAGATGAATGG + Intergenic
1019747890 7:2710697-2710719 GGCAGTCAAGGGAAGGTGAAGGG + Intronic
1020483606 7:8693042-8693064 AAGAGGCAAGTGAAGGGGCAAGG + Intronic
1020638932 7:10731522-10731544 GAGAGCCAGGTGGTGGTGTAGGG - Intergenic
1021414361 7:20365204-20365226 AAGAGCTAAGTCAAGGAGAAAGG + Intronic
1021676844 7:23088935-23088957 GAGGGGCATGTGAAGGTAAAGGG + Intergenic
1023072640 7:36452028-36452050 TAGAGCCAGGTGAAGGTCCATGG + Intronic
1023578115 7:41651887-41651909 GAGAGCAAAATGAAGGTGGTGGG - Intergenic
1023710622 7:42988552-42988574 GGGAGGCAAGAGAATGTGAATGG - Intergenic
1024561668 7:50649918-50649940 GAGACCCAAGTGAAGACGGAGGG + Intronic
1026447901 7:70501566-70501588 GAGAGGCCTGTGATGGTGAAAGG - Intronic
1026511930 7:71034536-71034558 GAGAGCAAAGTGAAGAAGCAGGG - Intergenic
1027717086 7:81686235-81686257 GAGAGCCAAGCAAAGGGGGAAGG + Intergenic
1028888866 7:95964699-95964721 AAAAAACAAGTGAAGGTGAAGGG + Intronic
1029138059 7:98389132-98389154 GACAGGCATGTGAAGGTGACAGG + Intronic
1031268708 7:119616870-119616892 CAGAAGCAAGTGAAGGGGAAAGG - Intergenic
1033134394 7:138772956-138772978 GAGAGCCAAGGGGAGGAGGAGGG + Intronic
1033511019 7:142060359-142060381 GACAGCCAAGTGGAGGTAAAAGG + Exonic
1033513823 7:142086703-142086725 GACAGTCAAGTGGAGGTAAAGGG + Intronic
1033733233 7:144198059-144198081 GAGAACCAACTGAAGCTGGAGGG - Intergenic
1033749817 7:144352928-144352950 GAGAACCAACTGAAGCTGGAGGG + Intergenic
1034831617 7:154313191-154313213 GAGAGCCAAGGTAGGGGGAAAGG + Intronic
1037415012 8:18640518-18640540 GAGAGCCAAGTGAAGGTGAAGGG - Intronic
1037959692 8:23086886-23086908 AAGAGCCAATTAATGGTGAAAGG + Intronic
1038190253 8:25313729-25313751 GACAACCAAGTGAAGACGAAGGG - Intronic
1039133297 8:34292373-34292395 GAAACCCAAGTGAAGTTGGAGGG + Intergenic
1039973718 8:42342256-42342278 GAAGGCCAAGTGGAGGTGACTGG - Intronic
1040464975 8:47686031-47686053 GAGAGAGAAGGGAAGGGGAAGGG + Intronic
1042003294 8:64151388-64151410 GAAAGGCAAGTGAAAGTTAAAGG - Intergenic
1043230306 8:77791745-77791767 AATAGCCAAGTGAACTTGAATGG + Intergenic
1044332222 8:90934026-90934048 GAGAGCAAAGTGGAAGAGAAAGG - Intronic
1044675388 8:94722826-94722848 AGGATCCAAGTGAATGTGAATGG - Intronic
1044722171 8:95161033-95161055 GAGAACCAAGAGAAGAAGAAAGG + Intergenic
1045523544 8:102923879-102923901 GAAGGCCAAGTGGAGGTGACTGG - Intronic
1047254838 8:123207149-123207171 CAGAGCCAGGTGAAGCTGGAGGG - Exonic
1049058947 8:140260892-140260914 GAGAGGCTCATGAAGGTGAAGGG + Intronic
1050468417 9:5958413-5958435 GAAAACCAGGTGAAGGAGAAGGG - Intronic
1051348537 9:16175455-16175477 CAGAGCCAAGAGAAGGGTAAGGG - Intergenic
1054694739 9:68348904-68348926 GAGATGAAAGTTAAGGTGAACGG + Intronic
1056716903 9:89038865-89038887 GGGAAACAAGTGAAGGTTAAGGG - Intronic
1057408386 9:94794219-94794241 GAGAGCCAAAAGAGGGAGAAGGG + Intronic
1058929477 9:109704794-109704816 GAGAGCCAAGTTGAAGTGAATGG - Intronic
1059714471 9:116900777-116900799 GAGAACCAAACGAAGGTGGAGGG - Intronic
1060854202 9:126901873-126901895 GACAGCCAAATGGAGGAGAATGG + Intergenic
1061840169 9:133354026-133354048 GCCAGACAAGTGAAGGAGAAAGG + Intronic
1185456683 X:314273-314295 GAGGTCGAGGTGAAGGTGAAGGG + Intronic
1186338427 X:8617427-8617449 CAGAGCCACGTGAAGGGGCAAGG + Intronic
1191104396 X:56763674-56763696 GAGAGCCAAAGGAAGGGCAAAGG + Intergenic
1191659313 X:63634080-63634102 GAGAGCCAAGAAATGGAGAAAGG + Intergenic
1192970357 X:76221860-76221882 GAGAGCCAAGTGAAACTCAGGGG - Intergenic
1193236486 X:79113652-79113674 GAGAGAGAAGAGAAAGTGAATGG + Intergenic
1193398314 X:81012302-81012324 GAGAGAGAAGAGAAAGTGAAGGG - Intergenic
1196055976 X:111355698-111355720 CAGAGCCAAGAGAAGGGGAAAGG + Intronic
1197083436 X:122445921-122445943 GAGAGCCAAGTGAAATACAAGGG + Intergenic
1197571465 X:128156047-128156069 CAGAGCAAAGTAAAGGTGAGTGG + Intergenic
1198217948 X:134573883-134573905 AGGAGCCAAATGATGGTGAATGG - Intronic
1198225653 X:134642658-134642680 GTCAGCCAAGTGAAAGGGAAGGG + Intronic
1199324619 X:146482887-146482909 AAGTGCCAAGCGAAGGGGAAAGG + Intergenic
1199860563 X:151797310-151797332 GGGCACCAAGTGAAGGAGAACGG - Intergenic