ID: 1037415042

View in Genome Browser
Species Human (GRCh38)
Location 8:18640722-18640744
Sequence CAGTAAGACTGGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037415036_1037415042 26 Left 1037415036 8:18640673-18640695 CCCAGTCTTGGGCAGTTCTTTAT 0: 289
1: 584
2: 1416
3: 5878
4: 9698
Right 1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG No data
1037415037_1037415042 25 Left 1037415037 8:18640674-18640696 CCAGTCTTGGGCAGTTCTTTATA 0: 307
1: 577
2: 1315
3: 3452
4: 8374
Right 1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037415042 Original CRISPR CAGTAAGACTGGAGGGAAGA TGG Intronic
No off target data available for this crispr