ID: 1037416702

View in Genome Browser
Species Human (GRCh38)
Location 8:18659084-18659106
Sequence TCGGCCCATCTCTGAAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037416698_1037416702 18 Left 1037416698 8:18659043-18659065 CCCATGGACAGATCTGCGTGGCT 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1037416702 8:18659084-18659106 TCGGCCCATCTCTGAAGCCAAGG No data
1037416695_1037416702 27 Left 1037416695 8:18659034-18659056 CCTATCCTTCCCATGGACAGATC 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1037416702 8:18659084-18659106 TCGGCCCATCTCTGAAGCCAAGG No data
1037416696_1037416702 22 Left 1037416696 8:18659039-18659061 CCTTCCCATGGACAGATCTGCGT 0: 1
1: 0
2: 0
3: 3
4: 115
Right 1037416702 8:18659084-18659106 TCGGCCCATCTCTGAAGCCAAGG No data
1037416699_1037416702 17 Left 1037416699 8:18659044-18659066 CCATGGACAGATCTGCGTGGCTA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1037416702 8:18659084-18659106 TCGGCCCATCTCTGAAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037416702 Original CRISPR TCGGCCCATCTCTGAAGCCA AGG Intronic
No off target data available for this crispr