ID: 1037417133

View in Genome Browser
Species Human (GRCh38)
Location 8:18664003-18664025
Sequence TCTTATGTGGAGATGGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 1, 2: 2, 3: 35, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037417133 Original CRISPR TCTTATGTGGAGATGGTTAA TGG (reversed) Intronic
904387808 1:30156615-30156637 ACTTATGTGAAGAAGGTCAATGG + Intergenic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
906404263 1:45529062-45529084 TTTTTTGTGGAGATGGTGAAGGG - Intergenic
907735453 1:57107403-57107425 TATTATGTTGAGATGCTTGATGG - Intronic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909613646 1:77581059-77581081 TCTTATGTGCAGATGATAAGAGG - Exonic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
910352605 1:86316060-86316082 TCTCATGATGAGATGCTTAAAGG + Intergenic
910561233 1:88593637-88593659 ACTTAAGTGGAGATGGTTAATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
912792978 1:112671690-112671712 TCTTATGTTGAGAATGTTTAGGG + Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
914970019 1:152300304-152300326 GGGTAAGTGGAGATGGTTAATGG + Intergenic
917286900 1:173430801-173430823 TCTTATGTTGAGATTTTTATAGG - Intergenic
917735239 1:177914172-177914194 TCTAATGGGGAGATGGTCTAGGG - Intergenic
918456986 1:184731342-184731364 TCTTCTGTGTTGATAGTTAAAGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918773119 1:188590043-188590065 TGTTTTGTGGAGATGTTTAAAGG - Intergenic
919282533 1:195509738-195509760 ATTTATGTGGAGATGGTGAAAGG - Intergenic
920815395 1:209326743-209326765 TCTCATTTGAAGATAGTTAACGG + Intergenic
920981508 1:210840668-210840690 TCTTCTCTAGAGATGTTTAAGGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
923384475 1:233453002-233453024 TCTTATGGGGAGATGGAGAGGGG - Intergenic
924192557 1:241569291-241569313 TGTAAAGTGGAGATAGTTAATGG - Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1064851426 10:19713315-19713337 TCTTATCTGGATATGGTTCCAGG - Intronic
1065388862 10:25161660-25161682 GATAAAGTGGAGATGGTTAATGG - Intergenic
1066214677 10:33274623-33274645 TCTACAGTGGAGATGGTTAATGG + Intronic
1066495476 10:35937910-35937932 TTTTATGTGGACATGGAGAAAGG - Intergenic
1067565998 10:47337698-47337720 TCTTATGGGGAGATGTAAAATGG - Intergenic
1068880051 10:62038652-62038674 TCTTATGTGGAGATTGGACAAGG - Intronic
1069200218 10:65605511-65605533 TTTTATGTGGAGATATTTTAAGG - Intergenic
1070376297 10:75834276-75834298 GCTTCTGTTGAGATGGTTGAGGG + Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071739074 10:88336429-88336451 TCTTATGTGGAGTTGTTTAGAGG - Intronic
1071903149 10:90142306-90142328 TCTTATGTGTGGATGGCTGAGGG + Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073522383 10:104145339-104145361 TTTTAGGTGGAGATGTTTAAGGG - Intronic
1075231096 10:120679039-120679061 TCTTATGGGCAGATGGTGATGGG - Intergenic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1079644475 11:22845369-22845391 TCTTATGTGGTGGCGGGTAAGGG - Intergenic
1080152355 11:29068036-29068058 TCTTTTGTGGATATCGTGAATGG - Intergenic
1080959937 11:37146412-37146434 TCTTAGGTGGAGATGGGAACTGG - Intergenic
1083057963 11:59841458-59841480 TCTTAAATGGAGATGATTACAGG - Intronic
1086356872 11:86010090-86010112 TCTTTGGTGGAGATGGGTAGAGG + Intronic
1086999283 11:93397297-93397319 TCTTCTTTGGGCATGGTTAATGG + Intronic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1089853342 11:121518843-121518865 GATTGTGTGGAGATGGTTGATGG + Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1092046654 12:5435699-5435721 TGTTATGTGGAGCTGGAGAATGG + Intronic
1094237017 12:28179490-28179512 TCAAATGTGGATATGGTAAATGG + Intronic
1094633207 12:32198291-32198313 TCTTATGAGGGGATGATTATGGG + Intronic
1095551860 12:43451628-43451650 TTTTATGGGGAGGTGGGTAAAGG - Intronic
1095709946 12:45277598-45277620 TCTTATGTAGAAAGGGTTAAAGG + Intronic
1097387888 12:58972461-58972483 TGGGTTGTGGAGATGGTTAATGG - Intergenic
1097658206 12:62395612-62395634 TGTAAGGTGGGGATGGTTAACGG - Intronic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1101121284 12:101583151-101583173 TCTTATGAGGAGAGGCTTAGAGG + Intronic
1102297606 12:111749033-111749055 TCTTACTGGGACATGGTTAAAGG - Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1106970537 13:35136247-35136269 TCTAATGTGGGGATTATTAAGGG - Intronic
1107079969 13:36364424-36364446 TATTATGTGGAGGTGGATTAGGG - Intronic
1107397913 13:40037365-40037387 TTTTATGTGGTGATGGTGAAAGG + Intergenic
1109106968 13:58265165-58265187 TTATATATGGAGATGCTTAATGG - Intergenic
1111531839 13:89546899-89546921 TCTTATGTGGAGTTAGAGAATGG - Intergenic
1112086684 13:96039438-96039460 GCTTCTGGGGAGATGGTTGAGGG + Intronic
1112166474 13:96925654-96925676 ACTTATGTGGAAATAGATAAGGG - Intergenic
1112531908 13:100212847-100212869 GGTGATGTGGGGATGGTTAATGG - Intronic
1113057153 13:106281200-106281222 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1113564491 13:111311257-111311279 TTTTCTGTGTTGATGGTTAAAGG + Intergenic
1114835020 14:26193827-26193849 TATAGTGTGGAGATGGGTAAAGG - Intergenic
1115013124 14:28574505-28574527 TCTCATATGGACATGGTTTATGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1118133651 14:62997289-62997311 TAAGATGGGGAGATGGTTAATGG + Intronic
1118939627 14:70320937-70320959 GCTTACGTGGAGATGATTAGTGG + Intergenic
1119330348 14:73788717-73788739 TATTGTGGGGAGATGGTGAAGGG + Intronic
1119529854 14:75352490-75352512 TTTAAGGTGGAGATGGATAATGG + Intergenic
1121594410 14:95148678-95148700 TCTTATATGGAGATCTTTGATGG - Intronic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122993873 14:105252071-105252093 TCTTGTGTGGACAAGGTTTAAGG - Intronic
1123138960 14:106056458-106056480 TCTTACCTGGAGTTGGTTCAGGG - Intergenic
1124091420 15:26606176-26606198 TATTAGGTGGGGATGGTTAATGG + Intronic
1124470463 15:29979783-29979805 TATTATGAGGAGAAAGTTAAAGG + Intergenic
1124639254 15:31385629-31385651 TCTTATATGGAAGTGGTTCATGG - Intronic
1128010253 15:64287696-64287718 TCTTTTATGAAGATGGTTAAAGG + Intronic
1129305254 15:74656140-74656162 TCTTTTGTGGAGAGTGTTACAGG + Intronic
1130345249 15:83038234-83038256 TTTTGTGTGGACATGGTAAATGG - Intronic
1130359624 15:83170537-83170559 TCTTATGTGGTGAAAGTTACAGG - Intronic
1131860085 15:96644479-96644501 TTTAATGTGGGGATGGATAAAGG + Intergenic
1131955532 15:97731256-97731278 TTTTATGTGAACATTGTTAAAGG - Intergenic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1134087664 16:11369433-11369455 TCTTTTGTTGCGAAGGTTAATGG + Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1138018362 16:53453211-53453233 ATTTATGTAGAGATGGTTAAGGG - Intronic
1142650224 17:1344957-1344979 TGTTAGCTTGAGATGGTTAAAGG - Exonic
1143501124 17:7339765-7339787 TGGTGTGTGGTGATGGTTAAAGG - Intronic
1145285304 17:21501342-21501364 TCTAATTTGCAGTTGGTTAAAGG - Intergenic
1145392221 17:22464404-22464426 TCTGATTTGCAGTTGGTTAAAGG + Intergenic
1145944626 17:28763993-28764015 TGTTATCTGAAGATGGTTTAAGG + Intronic
1146585900 17:34081220-34081242 TCCCATGTGGAGTTTGTTAATGG - Intronic
1150995979 17:70318349-70318371 TCTTTTGTGGAGATGGTAAATGG - Intergenic
1151774372 17:76189257-76189279 CCTTAGGTGGAGCTGGATAAAGG + Intronic
1152223758 17:79083220-79083242 TCCTATGGGGGGGTGGTTAAGGG + Intronic
1153791044 18:8579802-8579824 TCTTATGTTGAGATGGAAGAGGG - Intergenic
1155258773 18:24021674-24021696 TCTTATGTAAAGATGGTTGGTGG + Intronic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155282874 18:24258497-24258519 GGGAATGTGGAGATGGTTAATGG + Intronic
1155542324 18:26881555-26881577 TCTCATTTGAAGGTGGTTAAAGG + Intergenic
1156159050 18:34337238-34337260 TAATATGTGCATATGGTTAATGG - Intergenic
1156561283 18:38128568-38128590 TTTTATGTGGAGATGGAAAATGG + Intergenic
1156680499 18:39582787-39582809 TCTAATGTGAAGACGGTTGATGG + Intergenic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1157321829 18:46640578-46640600 TTATATGTTGAGATGGTAAATGG - Intronic
1159003236 18:62991506-62991528 TCTCCTGGGGAGATGGGTAAGGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1161537144 19:4826865-4826887 GCTTATGTGGACCTGGTTATGGG + Intronic
1164029231 19:21386211-21386233 TCTTATGTGCAGAAAGTTGAGGG - Intergenic
1166366675 19:42281472-42281494 CCTTCTGTGGAGTTGGTTAGGGG + Intronic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
1167300983 19:48677352-48677374 GATTGTGGGGAGATGGTTAAAGG + Intergenic
1168498547 19:56874509-56874531 TCTTATGTTGAGTTGGTTCTGGG - Intergenic
927322550 2:21764284-21764306 TCTTATATGGATGTGGTTCATGG + Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928117858 2:28560404-28560426 TCTTATGTGTATAAGGTAAAGGG + Intronic
928505634 2:31949616-31949638 TAGGAGGTGGAGATGGTTAATGG + Intronic
928533599 2:32217812-32217834 TCTTTTGTGGATATTGTAAATGG + Intronic
931880423 2:66563897-66563919 TCAAATGTGGAGATTGTTTAAGG + Intronic
933037058 2:77413088-77413110 TCCCATGTGCAGTTGGTTAATGG + Intronic
933060256 2:77727614-77727636 ACTTTTGTGGAGATGGTTTTTGG + Intergenic
934634743 2:95974073-95974095 ACTTATATATAGATGGTTAAAGG + Intronic
934834547 2:97572304-97572326 ACTTATATATAGATGGTTAAAGG + Intronic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
937101820 2:119277157-119277179 CTTTATGTGGGGATGTTTAAAGG + Intergenic
937804945 2:126128569-126128591 TCATATGTGCATATGGATAACGG - Intergenic
939502239 2:143002094-143002116 TCTTCGGTGGAGCTGGTTCAAGG + Intronic
940503194 2:154520520-154520542 GGATAGGTGGAGATGGTTAATGG - Intergenic
940608429 2:155958692-155958714 TCTTATATGGATGTGGTTCATGG - Intergenic
941081446 2:161065619-161065641 TCTTATGTGGGGCTGGAGAAGGG + Intergenic
941844460 2:170119504-170119526 TCCTGTGTGCAGATGATTAAAGG - Intergenic
941974558 2:171388884-171388906 TTTTATATGGATATGGTTCATGG - Intronic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
944079611 2:195772004-195772026 TCTTGTGTGGAGATGGATCATGG - Intronic
944529565 2:200653914-200653936 TCTTATATGGATGTGGTTCATGG - Intronic
945338658 2:208623191-208623213 TCTAAAGTGGGGATGGTTAATGG - Intronic
947747149 2:232514128-232514150 TCTGATGTAGAGATGGTTCTTGG - Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1169778816 20:9286356-9286378 TCATATGAGGAGGTGGTTATGGG + Intronic
1171453102 20:25249644-25249666 TCTAAAATGGAGATGGTAAAAGG + Intronic
1172803734 20:37596671-37596693 TTTTATGTGGAGATGGGGCACGG - Intergenic
1173378373 20:42511444-42511466 TCTTATTTGGAGTTGATTGAAGG + Intronic
1173547426 20:43909632-43909654 TCCTGTGTGCAGATGGTTATTGG + Intergenic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1175459877 20:59144576-59144598 TCATATGAGGAGATGGTGACGGG + Intergenic
1176702523 21:10072678-10072700 TCTTATATGGATGTGGTTCATGG + Intergenic
1177755524 21:25342573-25342595 TCTCATGTGGAGAAGGCTATAGG + Intergenic
1181329369 22:22077496-22077518 GGTGATGTGGGGATGGTTAATGG - Intergenic
1181404855 22:22676289-22676311 TCTTATTAGGGGATGCTTAATGG - Intergenic
1181413374 22:22741498-22741520 TCTTATTTGTGGATGCTTAATGG - Intronic
1181418352 22:22777011-22777033 TATTATCTGGGGATGGTTAATGG - Intronic
949742566 3:7253236-7253258 TATTATGTGGAGAGGGTATAAGG - Intronic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
954013238 3:47662301-47662323 TCTGTTGAGGAGATGGTTTAGGG + Intronic
955271582 3:57505216-57505238 TGGTAAGTGGAGATGTTTAATGG - Intronic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956491227 3:69774295-69774317 TCTTATTAGAAGATGGTTTAGGG + Intronic
957401708 3:79724251-79724273 TTTTATTTTAAGATGGTTAATGG + Intronic
959821219 3:110737541-110737563 TCTCATATGGAGATGGTTCGTGG + Intergenic
960242117 3:115356594-115356616 GAGTATATGGAGATGGTTAAAGG + Intergenic
961473604 3:127133860-127133882 TTTTATCTGGACATGGTTGAAGG - Intergenic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
964452833 3:156828048-156828070 GCTTATGTTGACATGGTTAATGG + Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
966264940 3:178028568-178028590 TATTATATGGAGAGGGTGAAGGG + Intergenic
966477390 3:180366204-180366226 TCTTGGGTGGGGGTGGTTAAGGG - Intergenic
970135849 4:12922941-12922963 TCTTAAGGGTGGATGGTTAATGG - Intergenic
970394615 4:15654375-15654397 ACTTTTGTGGAGATGGTTCAGGG - Intronic
970482628 4:16492995-16493017 TTTAATGTGGAGATGGCAAATGG + Intergenic
970504234 4:16710822-16710844 TATTATTGGGAGATGGTTCAGGG - Intronic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
971556403 4:28017651-28017673 TCAGATGTGGAGATAGTTTAGGG + Intergenic
973001115 4:44951958-44951980 TATAAGGAGGAGATGGTTAATGG + Intergenic
973617812 4:52696820-52696842 TTTTATGTGGTGATTGTGAATGG - Intergenic
975662295 4:76699737-76699759 GCTTTTCTGGAGATGATTAATGG + Intronic
976320665 4:83710876-83710898 CGTTATGTGGAAATGGTGAAAGG - Intergenic
976468495 4:85399282-85399304 TCTTCTGTGGAGGTGGTTTGTGG - Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977652002 4:99481079-99481101 TCTTTTGTGGTGATTGTGAATGG + Intergenic
979008687 4:115338389-115338411 TATTATGTGGAGAGGCTAAAGGG - Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979853939 4:125609070-125609092 TCTTGTGTGGAGGTGGGGAAGGG - Intergenic
980028820 4:127800535-127800557 TGTTATTTGGTGATTGTTAAAGG + Intronic
980774959 4:137425741-137425763 TCTTCTGTGGAGAGGGGAAAGGG + Intergenic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983764421 4:171459958-171459980 TCTTATATGGACCTGGTTAATGG + Intergenic
984850875 4:184151486-184151508 TCTTATGTGGAGGGGGCTCAAGG + Intronic
987382249 5:17296025-17296047 TCATTTCTGGAGATGTTTAATGG - Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988830137 5:34978992-34979014 TTTTATTTGGAAATGGATAATGG - Intergenic
989099001 5:37807387-37807409 AGAGATGTGGAGATGGTTAATGG + Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
995214400 5:109578580-109578602 TCTTATATGGATGTGGTTCATGG + Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
996607043 5:125335385-125335407 TCTTATTAGGATATGGTAAAGGG - Intergenic
997705369 5:135946222-135946244 TCTTATGTGTAGATTGTTAGAGG - Intronic
998816841 5:146023079-146023101 TTTAATGTATAGATGGTTAAGGG - Intronic
999019506 5:148148049-148148071 TCTTATATGAAGATGTTGAAGGG - Intergenic
999733529 5:154494162-154494184 TCTGTTGTGGAAATGGGTAATGG - Intergenic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1000162850 5:158617092-158617114 AGTTTTGTGGAGGTGGTTAAGGG + Intergenic
1002380710 5:178826843-178826865 TATTGTGTGGAAATGTTTAAAGG - Intergenic
1008855608 6:56082714-56082736 TATTTGGTGGGGATGGTTAATGG - Intronic
1010745144 6:79552176-79552198 TCTTATGAGGAGAAAGTTACTGG + Intergenic
1010857313 6:80856412-80856434 TCTGATGAGGAAATGGGTAAAGG + Intergenic
1011335290 6:86253217-86253239 CCTTATTTGGAGCTGCTTAATGG + Intergenic
1011577931 6:88825123-88825145 TCTTAAGTGAAAATGCTTAAAGG + Intronic
1011901928 6:92309056-92309078 AGGAATGTGGAGATGGTTAATGG + Intergenic
1012065923 6:94552249-94552271 GCTTGTGTTTAGATGGTTAAAGG + Intergenic
1014159010 6:118145336-118145358 ACTTATGTGGATCTGGTTAAAGG + Intronic
1014508395 6:122288905-122288927 TTTTATGTAAAGATGCTTAATGG - Intergenic
1015199936 6:130568127-130568149 TGGGAGGTGGAGATGGTTAATGG - Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1019331372 7:462395-462417 TCTTATGGGGAGGTGGGTACAGG + Intergenic
1020221999 7:6245988-6246010 TTTTTTGGGGAGAGGGTTAATGG - Intronic
1024257952 7:47552614-47552636 TCTTATATGGATTTGGTTCATGG - Intronic
1027368625 7:77484405-77484427 TCTTTTGTGGATATTGTAAATGG + Intergenic
1028041759 7:86062426-86062448 ATTTATGTAGAGATGATTAAAGG - Intergenic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1028889707 7:95973025-95973047 TCTTGTGTGGACCTGGATAAGGG + Intronic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030748084 7:113193357-113193379 GGGTATGTGGGGATGGTTAATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1032770075 7:135043469-135043491 GCAGAAGTGGAGATGGTTAATGG + Intronic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1037417133 8:18664003-18664025 TCTTATGTGGAGATGGTTAATGG - Intronic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1041466453 8:58162362-58162384 TCTTATGGTAAGATGGCTAAAGG + Intronic
1043645914 8:82518364-82518386 GCTTATGTTGAGATGGCTGATGG + Intergenic
1043725087 8:83601345-83601367 AGTAATGTGGGGATGGTTAATGG + Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1044801887 8:95965502-95965524 TCTTATGCGCAGATGATTCAGGG - Intergenic
1045441788 8:102220816-102220838 TCTTTTTTGGAGAAGATTAAAGG + Intronic
1046029630 8:108768115-108768137 ACTTAAGTGAAGATGGCTAATGG - Intronic
1047187672 8:122648947-122648969 TGTAATGTGGGGATGGTGAATGG - Intergenic
1048902460 8:139051866-139051888 TCTTATGTGAACATGGTTTGTGG - Intergenic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1051009407 9:12392972-12392994 TCTCATGTTGAGAAGGCTAATGG + Intergenic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052002544 9:23303761-23303783 TCTTATGTAGATATTTTTAACGG - Intergenic
1052290317 9:26832962-26832984 TCTTCTGTGAAGATGGTGAATGG - Intergenic
1052698822 9:31912894-31912916 CTTTATGTGAAAATGGTTAAGGG - Intergenic
1053639724 9:40059395-40059417 TCTTATATGGATGTGGTTCATGG + Intergenic
1054320473 9:63655734-63655756 TCTTATATGGATGTGGTTCATGG + Intergenic
1054545026 9:66317220-66317242 TCTTATATGGATGTGGTTCATGG - Intergenic
1055377230 9:75662309-75662331 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1056911954 9:90709191-90709213 CCTTGTTTGGAGATGGTTAGGGG - Intergenic
1058009075 9:99955553-99955575 TCTTATGTGGTAAAGGTTAGTGG + Intronic
1058837548 9:108872202-108872224 GCTCATGTGGAGATGGTTAGCGG + Intronic
1059203727 9:112443985-112444007 GCTTATGTGGAGATGGCTATAGG - Intronic
1059650696 9:116313324-116313346 TCATATGTGCAGGTGGTGAAAGG + Intronic
1059809481 9:117839768-117839790 TTTTGTGTGGGGAAGGTTAATGG + Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061070016 9:128303815-128303837 TCCTAAGTGGAAATGCTTAACGG + Intergenic
1202787542 9_KI270719v1_random:42770-42792 TCTTATATGGATGTGGTTCATGG + Intergenic
1185723813 X:2403290-2403312 TGTGCCGTGGAGATGGTTAATGG - Intronic
1187493666 X:19776245-19776267 TCTGATGTGGAAATGTTTTATGG + Intronic
1187580493 X:20602564-20602586 TGTTATGTGGAGAAAGATAAGGG - Intergenic
1187727199 X:22215702-22215724 TCAGAAGTGGGGATGGTTAATGG - Intronic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1187985252 X:24803083-24803105 TCATGTTTGGAGCTGGTTAAGGG + Intronic
1189666378 X:43359100-43359122 ACTTATGTGTATATGGTAAATGG + Intergenic
1190861700 X:54351454-54351476 TCTTTTGTACAGATTGTTAATGG - Intronic
1192854399 X:74993209-74993231 GAGGATGTGGAGATGGTTAATGG + Intergenic
1193529146 X:82633700-82633722 TTTATTGTGGAGATGCTTAAGGG - Intergenic
1193761561 X:85473187-85473209 TGGGAAGTGGAGATGGTTAATGG + Intergenic
1193886820 X:86993233-86993255 TTTGCAGTGGAGATGGTTAATGG - Intergenic
1193906000 X:87244898-87244920 TCTTATTTGGGGGTGGTTTAGGG - Intergenic
1194326683 X:92527139-92527161 GATGAGGTGGAGATGGTTAATGG + Intronic
1194841169 X:98744841-98744863 TGTGAGATGGAGATGGTTAATGG - Intergenic
1195851596 X:109288288-109288310 CAGGATGTGGAGATGGTTAATGG - Intergenic
1196109428 X:111930331-111930353 TTTTAAGTAGAGATGGTTGATGG + Intronic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1197676085 X:129331882-129331904 ACTTATGTCGAGTTGGTTGATGG + Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198341805 X:135721453-135721475 TCTTACTTGGTTATGGTTAAAGG + Intronic
1198346189 X:135761909-135761931 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198348094 X:135779194-135779216 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198350000 X:135796456-135796478 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198351912 X:135813729-135813751 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198353814 X:135830998-135831020 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198355728 X:135848247-135848269 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198357639 X:135865526-135865548 TCTTACTTGGTTATGGTTAAAGG - Intergenic
1198359547 X:135882809-135882831 TCTTACTTGGTTATGGTTAAAGG - Intronic
1198612805 X:138420638-138420660 TAATAAGTGGGGATGGTTAAGGG + Intergenic
1199111330 X:143938312-143938334 GGGGATGTGGAGATGGTTAATGG + Intergenic
1199165966 X:144675686-144675708 TGTTATGTGTTGGTGGTTAATGG - Intergenic
1199195437 X:145023869-145023891 GCTTAAGTGGCAATGGTTAATGG + Intergenic