ID: 1037418526

View in Genome Browser
Species Human (GRCh38)
Location 8:18677177-18677199
Sequence CAGAGGAACTAGAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037418521_1037418526 5 Left 1037418521 8:18677149-18677171 CCAGCAGGATTTGAGAAATTCAC 0: 1
1: 0
2: 1
3: 10
4: 204
Right 1037418526 8:18677177-18677199 CAGAGGAACTAGAGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037418526 Original CRISPR CAGAGGAACTAGAGGAAGGA GGG Intronic
No off target data available for this crispr