ID: 1037419091

View in Genome Browser
Species Human (GRCh38)
Location 8:18682997-18683019
Sequence CCACTCCACAGGTTTAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037419091_1037419096 13 Left 1037419091 8:18682997-18683019 CCATTTTTAAACCTGTGGAGTGG 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1037419096 8:18683033-18683055 TACCCTGCTCACACAGATGGTGG No data
1037419091_1037419100 17 Left 1037419091 8:18682997-18683019 CCATTTTTAAACCTGTGGAGTGG 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1037419100 8:18683037-18683059 CTGCTCACACAGATGGTGGTGGG No data
1037419091_1037419095 10 Left 1037419091 8:18682997-18683019 CCATTTTTAAACCTGTGGAGTGG 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1037419095 8:18683030-18683052 GAGTACCCTGCTCACACAGATGG No data
1037419091_1037419099 16 Left 1037419091 8:18682997-18683019 CCATTTTTAAACCTGTGGAGTGG 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1037419099 8:18683036-18683058 CCTGCTCACACAGATGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037419091 Original CRISPR CCACTCCACAGGTTTAAAAA TGG (reversed) Intronic
900430713 1:2601852-2601874 CCACTACACAGGTGCAGAAACGG + Intronic
903622195 1:24705836-24705858 CCACTTCACAGGGTTATGAAAGG + Intergenic
906652962 1:47526199-47526221 CCAACCCACAGCTTTATAAATGG - Intergenic
906988850 1:50715802-50715824 CCCCTCCACATTTTTTAAAAAGG + Intronic
911065109 1:93781043-93781065 CCACTCCACAGCTCTATACATGG - Intronic
911723281 1:101214529-101214551 CCACTCCACACCTATTAAAATGG + Intergenic
915150665 1:153828399-153828421 CCATTCCACCTTTTTAAAAATGG - Intronic
917338845 1:173953580-173953602 ACACTACAGAGATTTAAAAAAGG - Intronic
919135605 1:193504865-193504887 CCTCGTGACAGGTTTAAAAAAGG + Intergenic
919284386 1:195536017-195536039 CCAATCCAAAGTTTTAAAATTGG - Intergenic
921847666 1:219901218-219901240 CCACTTTACAGGTGGAAAAATGG - Intronic
923043786 1:230339202-230339224 TCACTCCGCTGGTTTAAAAAAGG - Intronic
923701204 1:236302000-236302022 CATTTCCACAGGTGTAAAAATGG - Intergenic
1065195287 10:23258301-23258323 CACCTCCTAAGGTTTAAAAAAGG + Intergenic
1070039467 10:72761201-72761223 CATTTACACAGGTTTAAAAATGG - Intronic
1070920226 10:80180103-80180125 CAACTCCACAGGCTCTAAAAGGG + Intronic
1071705451 10:87993206-87993228 CTATTCCAGAGGATTAAAAAGGG - Intergenic
1072094336 10:92161960-92161982 TGACTCCACATTTTTAAAAAGGG + Intronic
1074161274 10:110838383-110838405 CAACTCCACAGGTTTGAACCTGG + Exonic
1077373785 11:2195739-2195761 CCATTCCACAGGTGGGAAAACGG + Intergenic
1086467274 11:87067926-87067948 TCACTTCACAGATTAAAAAAAGG - Intronic
1086843820 11:91722357-91722379 CCACTACACATGTATCAAAATGG - Intergenic
1087146309 11:94815394-94815416 GAACTCCACAGGTTATAAAATGG + Intronic
1088063132 11:105681367-105681389 CCACTTCACAAATATAAAAAAGG - Intronic
1088238858 11:107753375-107753397 TCACTTCACAGGCTTTAAAATGG - Intergenic
1088345773 11:108823148-108823170 GCACACCACAGTTTTACAAATGG + Intronic
1088807621 11:113366710-113366732 GCACTCCACAGCTGGAAAAACGG - Intronic
1092651160 12:10636801-10636823 CCACAGCACAGGTGGAAAAAAGG + Intronic
1093056101 12:14557123-14557145 CCACTCCACATGAGTCAAAATGG + Intronic
1094428283 12:30338633-30338655 CCACTCCACATGTCTGAAATTGG + Intergenic
1096176229 12:49521322-49521344 CCACTCCACAGGTCTAACACTGG - Intronic
1098099273 12:66996610-66996632 CCAAACCACAGGGGTAAAAATGG + Intergenic
1100747934 12:97666093-97666115 CAACTACACATGTTTAAAGAGGG + Intergenic
1104423151 12:128653638-128653660 CCACTTCACAGGTTAGGAAATGG - Intronic
1106857490 13:33868850-33868872 ACACTCCACAGGTAACAAAAAGG + Intronic
1107659343 13:42623233-42623255 GCACTACACAGGATTAAGAATGG - Intergenic
1112146588 13:96706863-96706885 CCTCTCCCCATGCTTAAAAATGG - Intronic
1115075294 14:29381946-29381968 TCACTCCATAGAATTAAAAAAGG - Intergenic
1118399216 14:65364152-65364174 CTACCTCACAGGTTTAAAATAGG + Intergenic
1123043632 14:105500689-105500711 CCAGTCCACAGGGTTAAAGCTGG + Intergenic
1123447122 15:20339448-20339470 ACACTCCCCAGGTTTAGAAGGGG - Intergenic
1123784755 15:23659377-23659399 CCAATAATCAGGTTTAAAAACGG + Intergenic
1126354245 15:47778137-47778159 CCAGTCCACAGGTTTAGATCTGG - Intergenic
1135328560 16:21543167-21543189 CCACTTCCTGGGTTTAAAAACGG + Intergenic
1135929772 16:26726633-26726655 CCCATCCACAGGTTGGAAAAAGG + Intergenic
1136338908 16:29629140-29629162 CCACTTCCTGGGTTTAAAAACGG + Intergenic
1137719111 16:50617294-50617316 CCCCTCCCCCAGTTTAAAAAAGG - Intronic
1137746298 16:50822761-50822783 CCACAGCAGAGGTTCAAAAAGGG + Intergenic
1138455668 16:57119329-57119351 CCCCTCCACAGCTCTGAAAAAGG + Intronic
1141490114 16:84367244-84367266 CCACTCCCCAGTTTCAACAAAGG - Intergenic
1142041585 16:87897705-87897727 CCACTTCCTGGGTTTAAAAACGG + Intronic
1203138383 16_KI270728v1_random:1744704-1744726 ACACTCCTCAGGTTTAGAAGGGG - Intergenic
1143816184 17:9517643-9517665 CCACTTCAGAGGTTTCATAAAGG + Intronic
1144891857 17:18498951-18498973 CCATTCCACAGATGGAAAAATGG + Intergenic
1145140365 17:20445366-20445388 CCATTCCACAGATGGAAAAATGG - Intergenic
1148319107 17:46734669-46734691 GTAGTCCACAGGTTTACAAAGGG - Intronic
1150038243 17:61827853-61827875 CCACTTCACACCCTTAAAAATGG + Intronic
1153268484 18:3295678-3295700 TAACTCCTCAGGTTTAATAATGG - Intergenic
1155838861 18:30623075-30623097 CCACTGAACAGTTTTAAGAAGGG + Intergenic
1157531360 18:48423443-48423465 CCACTCGACTGGATTCAAAATGG + Intergenic
1158751335 18:60264637-60264659 ACATTCCACGGATTTAAAAAAGG + Intergenic
1159808896 18:72992467-72992489 CCACTTCACAGATTTGAAACTGG - Intergenic
1160029400 18:75245480-75245502 GAGCTCCACAGGTTTAAAAATGG - Intronic
1161571980 19:5035779-5035801 CCCCTCCACGGGTTTGAGAAAGG - Intronic
925604416 2:5643779-5643801 CCACTCCTGTGGTTAAAAAAAGG + Intergenic
930175279 2:48295077-48295099 CCACTCCACTGGTGGAACAAGGG - Intergenic
931066942 2:58598064-58598086 CTACTCCAGGGTTTTAAAAATGG - Intergenic
932312989 2:70759124-70759146 CCACTTCACAGCTGGAAAAAAGG + Intronic
933765664 2:85706907-85706929 CCACTCAACATGGCTAAAAAGGG - Intergenic
934231878 2:90190981-90191003 CCACTCTACAGATTTCAAGAAGG + Intergenic
935006974 2:99088843-99088865 CTACTTCACAATTTTAAAAAAGG + Intronic
936919384 2:117671940-117671962 CCACTACACACCTTTCAAAATGG + Intergenic
937505708 2:122534250-122534272 CCTGGTCACAGGTTTAAAAATGG - Intergenic
939421425 2:141975609-141975631 CTACTCCACAGCTTTGAAAATGG - Intronic
944446822 2:199800302-199800324 CCACTCTACAGGTACAGAAACGG - Intronic
945516631 2:210770545-210770567 CCACTCAACATGTTTTAAAATGG - Intergenic
946171994 2:217901117-217901139 CCACTCGACAGCTGTGAAAAGGG - Intronic
946518848 2:220444171-220444193 CCATTCCACAGAATTAAAATTGG + Intergenic
946973326 2:225120034-225120056 CCAGTTCACAGGATAAAAAAGGG + Intergenic
1168873540 20:1152556-1152578 CCACTGGACAGGTTTTACAAGGG + Intronic
1172201155 20:33126936-33126958 CCAATCCACTGGATTAAAGATGG - Intergenic
1173452708 20:43179350-43179372 CATTTCCAGAGGTTTAAAAATGG - Intronic
1173591584 20:44229025-44229047 CCACTCCACACGATTCACAAGGG - Intergenic
1174961209 20:55159200-55159222 CCACTCAACAGGTTGTAATAAGG - Intergenic
1178084884 21:29102685-29102707 CCAGTCCACACTTTTAAAAAGGG - Intronic
1178500060 21:33118340-33118362 CCCATCCTCAGGTGTAAAAAAGG + Intergenic
1178953916 21:37006667-37006689 CCGCGCGCCAGGTTTAAAAACGG - Exonic
1180553203 22:16557442-16557464 ACACTCCCCAGGTTTAGAAGGGG - Intergenic
1181350848 22:22256816-22256838 ACACTCCCCAGGTTTAGAAGGGG + Intergenic
956084481 3:65595792-65595814 CCACCCCAGAGAGTTAAAAACGG - Intronic
956437831 3:69251604-69251626 CCTCTCCTCAGGTTTCAGAAGGG - Intronic
960665485 3:120104765-120104787 CCATTTTACAGGTTAAAAAATGG + Intergenic
960869585 3:122235179-122235201 TCATTCCACAAATTTAAAAAGGG + Intronic
962263278 3:133928239-133928261 TCGCTCCACAGGTCTATAAATGG - Exonic
964041264 3:152264606-152264628 GCACTCCTCTGGTTTAACAAGGG + Intronic
965533323 3:169798663-169798685 CCACTCAACATATTTTAAAAAGG + Intronic
965950142 3:174298819-174298841 CCACTCCAAAGATATAAATAGGG - Intergenic
968711324 4:2121047-2121069 CCACTGCACAAGATAAAAAAAGG - Intronic
971367079 4:25985958-25985980 CCACTCCACAGTGTGAAGAATGG - Intergenic
971371929 4:26027006-26027028 CAACTCCACAGGTCCAAAACTGG - Intergenic
971454449 4:26830923-26830945 CCTCTCCTCAGGGCTAAAAATGG - Intergenic
972256278 4:37359075-37359097 GCACTCAACAGGGTTATAAAAGG - Intronic
973903154 4:55498691-55498713 CCACTCCACAGATTGAGATATGG - Intronic
976075521 4:81295143-81295165 CCACTCCATAGGTGTATAATGGG - Intergenic
976814766 4:89134979-89135001 CCACTACACAGTGTTAAATAGGG - Intergenic
978148413 4:105405478-105405500 CCATTCCAAATGTTTAAAAGAGG - Intronic
979014487 4:115416184-115416206 CCAGTCCACAGGTTTACGCAGGG + Intergenic
980700886 4:136428647-136428669 GCACTCTACATGTTCAAAAATGG - Intergenic
982147132 4:152407244-152407266 CCTCCCCACATGTTTAAAATTGG + Intronic
984228421 4:177064004-177064026 CCACTACACAGGTTTACAAAAGG + Intergenic
997101790 5:130977722-130977744 CCACTACACAGCTGTTAAAATGG - Intergenic
997918416 5:137952665-137952687 CCAATCCAAAGGTATTAAAATGG - Exonic
1000576963 5:162986803-162986825 CCACTCCTCAGATGTAGAAAGGG + Intergenic
1000875988 5:166638905-166638927 CAACTGCTCGGGTTTAAAAAGGG - Intergenic
1001642093 5:173251690-173251712 CCACTCCAGAGCTTTTTAAAAGG - Intergenic
1003204522 6:3994940-3994962 CCGCTCCACAGTTTTAGAAGTGG - Intergenic
1004581092 6:16953691-16953713 CCACTACAAAGCTTTGAAAATGG - Intergenic
1008643124 6:53485121-53485143 CTAAGCCACAGGTGTAAAAATGG + Intergenic
1015290479 6:131532822-131532844 CCACTCCACTGGTGTAAGACAGG - Intergenic
1015393566 6:132710706-132710728 ACACTACACAGCTGTAAAAAAGG - Intronic
1015917828 6:138235638-138235660 ACAATGAACAGGTTTAAAAATGG + Intronic
1016254111 6:142083428-142083450 ACACACCACAGGACTAAAAAGGG - Intronic
1016716844 6:147243276-147243298 ACACTACACAGGTATTAAAATGG - Intronic
1017553473 6:155537384-155537406 TCACTGCAAAGGTTTTAAAAAGG + Intergenic
1019508863 7:1407168-1407190 GCACTGTGCAGGTTTAAAAATGG - Intergenic
1020526453 7:9265977-9265999 CCACTCCAGAGGATTAATAAAGG - Intergenic
1023585612 7:41726639-41726661 CCACTCCACAGGCTTTGAGAAGG + Intergenic
1026208792 7:68282994-68283016 CCACTTCAAAGATATAAAAAAGG + Intergenic
1026869511 7:73841956-73841978 CCACTTTACAGGTAGAAAAATGG + Intronic
1030134876 7:106236997-106237019 CCACTCTACAGATGAAAAAATGG - Intergenic
1032824879 7:135559064-135559086 CTACTCCAAAGGTGTATAAACGG - Intronic
1033683103 7:143615713-143615735 TCAGTTCAAAGGTTTAAAAAGGG + Intergenic
1033701509 7:143841926-143841948 TCAGTTCAAAGGTTTAAAAAGGG - Intergenic
1037419091 8:18682997-18683019 CCACTCCACAGGTTTAAAAATGG - Intronic
1037968528 8:23153673-23153695 CCACTTCACACCTGTAAAAATGG + Intronic
1038263867 8:26021469-26021491 CCCCTCCACAGGCTGAGAAAGGG + Intronic
1039679990 8:39723048-39723070 CCACTCTCCAGGTCTCAAAAAGG - Intronic
1040374930 8:46815813-46815835 CCAGCTCACAGGTATAAAAATGG + Intergenic
1047826718 8:128584282-128584304 TCACCCCACAGGTTAATAAAAGG - Intergenic
1050563617 9:6859561-6859583 CCAGTCCTCAGTTTTAAAATGGG - Intronic
1053650928 9:40169078-40169100 CTACTCCACATATTTAAATAGGG + Intergenic
1054533652 9:66207125-66207147 CTACTCCACATATTTAAATAGGG - Intergenic
1054986837 9:71271504-71271526 CCACCACACAGGTTGAGAAAGGG - Intronic
1056368925 9:85934951-85934973 CCCCTCCAAAACTTTAAAAAAGG + Intergenic
1058052206 9:100418205-100418227 TGACTCCACAGTTTTAAAACTGG - Intergenic
1058803513 9:108567612-108567634 CCACTCCACTGGATAAAAATTGG - Intergenic
1059458834 9:114416739-114416761 CTACTCCAAAGGTTGGAAAAGGG - Intronic
1059857011 9:118410480-118410502 CCGCTCCACAGGTATAAACAAGG + Intergenic
1060334435 9:122708316-122708338 CCACTACACAGCTATTAAAATGG + Intergenic
1061163885 9:128911465-128911487 CCCCTCCACAGATTAAAGAAGGG - Intronic
1061887775 9:133601375-133601397 CACCTCCACTCGTTTAAAAATGG - Intergenic
1061936781 9:133862225-133862247 CCACTCCACAGATCTCCAAAGGG + Intronic
1062409440 9:136415382-136415404 CCATTCCACTTGTTTAAAGACGG - Intronic
1189049012 X:37624255-37624277 CCACTCTGCAAGATTAAAAATGG + Intronic
1189908490 X:45785890-45785912 CAACTCCACATTTTTTAAAAAGG + Intergenic
1191769552 X:64740453-64740475 CCCCTCCACAGGAAAAAAAAAGG - Intergenic
1197354791 X:125424740-125424762 GCACTCCACAAGTTTAGAATAGG - Intergenic
1199415172 X:147573814-147573836 CCTCTCCTCAAGTTTAAGAAAGG - Intergenic
1199637486 X:149826989-149827011 GAAGTCCACAGTTTTAAAAAAGG + Intergenic
1200850998 Y:7883089-7883111 CCACCTCACAGGCATAAAAATGG - Intergenic