ID: 1037419094

View in Genome Browser
Species Human (GRCh38)
Location 8:18683008-18683030
Sequence CAGAAACACTCCCACTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037419094_1037419100 6 Left 1037419094 8:18683008-18683030 CCTGTGGAGTGGGAGTGTTTCTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1037419100 8:18683037-18683059 CTGCTCACACAGATGGTGGTGGG No data
1037419094_1037419099 5 Left 1037419094 8:18683008-18683030 CCTGTGGAGTGGGAGTGTTTCTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1037419099 8:18683036-18683058 CCTGCTCACACAGATGGTGGTGG No data
1037419094_1037419095 -1 Left 1037419094 8:18683008-18683030 CCTGTGGAGTGGGAGTGTTTCTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1037419095 8:18683030-18683052 GAGTACCCTGCTCACACAGATGG No data
1037419094_1037419096 2 Left 1037419094 8:18683008-18683030 CCTGTGGAGTGGGAGTGTTTCTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1037419096 8:18683033-18683055 TACCCTGCTCACACAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037419094 Original CRISPR CAGAAACACTCCCACTCCAC AGG (reversed) Intronic
901630707 1:10646902-10646924 CAGCAGCTCTCCCACTCCGCCGG - Intronic
902188508 1:14743636-14743658 CAGAATCTCTCCCTCTCCTCGGG + Intronic
902885025 1:19398481-19398503 CACAAACACTCCCACTTGAAGGG - Intronic
903023271 1:20409497-20409519 CAGAAAAACTCCCCATCCTCTGG - Intergenic
903183482 1:21617144-21617166 CACACACACTCCCAGTCCCCAGG - Intronic
905769503 1:40628429-40628451 GAGAATCACACCTACTCCACAGG + Intronic
912165560 1:107039051-107039073 CAGCAACGCCCCCACTCTACTGG - Intergenic
912796043 1:112694225-112694247 GAGAAACACTCCTCCTCCCCTGG - Intronic
914385009 1:147160242-147160264 CAGAAAGACACCCAATCCAATGG + Intronic
917233403 1:172862999-172863021 CACATATACTCCCACTCCACTGG - Intergenic
920206602 1:204296719-204296741 CAGAGACACCCCCACCTCACTGG + Intronic
922137302 1:222842039-222842061 CAGAAACACTCCAGTTCCTCAGG - Intergenic
922530348 1:226340494-226340516 CAGCAGCACCCCCACTCTACAGG - Intergenic
1062978002 10:1699748-1699770 TACACACAATCCCACTCCACCGG + Intronic
1062978062 10:1700044-1700066 CACACACAATCCCACTCCACCGG + Intronic
1062978120 10:1700338-1700360 CACACACAATCCCACTCCACCGG + Intronic
1062978146 10:1700464-1700486 CACACACAATCCCACTCCACCGG + Intronic
1062978172 10:1700590-1700612 CACACACAATCCCACTCCACCGG + Intronic
1062978206 10:1700758-1700780 CACACACAATCCCACTCCACCGG + Intronic
1062978282 10:1701136-1701158 TACACACAATCCCACTCCACCGG + Intronic
1062978380 10:1701642-1701664 CACACACAATCCCACTCCACCGG + Intronic
1063381906 10:5590942-5590964 CAGAAGCCCTCCCGCTCCAGGGG + Intergenic
1066753740 10:38687986-38688008 CACACACACACACACTCCACCGG + Intergenic
1067475231 10:46560553-46560575 CAAACAAACTGCCACTCCACTGG - Intergenic
1069143931 10:64864934-64864956 CAGAAACATCCCAACTCAACTGG + Intergenic
1070276262 10:75010244-75010266 GACAAACAATCCCACTCCACTGG - Intronic
1070287669 10:75095448-75095470 CAGTAACCCTCCCACTCCATAGG - Intronic
1070536758 10:77384435-77384457 CAGGAACAATGCCTCTCCACTGG - Intronic
1071847280 10:89534332-89534354 CAGAAACACATTCGCTCCACAGG - Intronic
1071924250 10:90387452-90387474 AGGAAACACACCCACTCCTCAGG + Intergenic
1074917861 10:117974951-117974973 CAGAAACACACCCTCTCATCTGG - Intergenic
1075199620 10:120391640-120391662 CTAAAACACTCCCCCTCCATTGG - Intergenic
1075261963 10:120970800-120970822 CAGACACTCCCCCACCCCACTGG - Intergenic
1076143796 10:128100299-128100321 CACAAGCCCTCCCCCTCCACTGG + Intronic
1081604177 11:44517063-44517085 CCCCATCACTCCCACTCCACTGG - Intergenic
1084180234 11:67442446-67442468 CAGAAAGGCACCCCCTCCACTGG + Exonic
1084535361 11:69753232-69753254 CAGACACACTCACACTTCCCAGG - Intergenic
1084599762 11:70137803-70137825 GAGACACAGTCCCACCCCACAGG + Intronic
1087498233 11:98917681-98917703 CACAAACACCCCAAGTCCACCGG + Intergenic
1089629106 11:119772766-119772788 CACAAACATTGCCATTCCACAGG - Intergenic
1090529761 11:127578470-127578492 AAGAAACACTTTCACTCCATTGG - Intergenic
1090934810 11:131331897-131331919 CATAAAAGCTCCCACACCACTGG - Intergenic
1092247728 12:6872850-6872872 CAGCAGCACCCCCACGCCACAGG - Exonic
1094494474 12:30980777-30980799 CAGACACACTCGCACCCCATGGG + Intronic
1095177359 12:39108786-39108808 CAGAAACATTCACACTCCAGAGG + Intergenic
1099362335 12:81720214-81720236 CAGAAACACTTGCTCTCAACAGG + Intronic
1102789215 12:115630333-115630355 CGCAAACACTCCCACTTCAAAGG + Intergenic
1103007642 12:117435001-117435023 CACACACACTCCTACTCCTCAGG + Intronic
1104728731 12:131093665-131093687 CAGAAACAGGCTCCCTCCACGGG + Intronic
1104808164 12:131602793-131602815 CAGCAGCACCCCCACTCTACTGG + Intergenic
1104970511 12:132528626-132528648 CTGAAACACACCCGCTCCCCCGG - Intronic
1106113910 13:26800950-26800972 CAGAAACATTTCCATTCAACTGG + Intergenic
1109442982 13:62398951-62398973 AAGAAACACCCCCAGTCCAAAGG + Intergenic
1110789222 13:79568991-79569013 CAGAAACCCTCCAACTCCTTTGG + Intergenic
1110918369 13:81052087-81052109 CAGAAACACTCACTTTCCACAGG - Intergenic
1115947454 14:38678096-38678118 CAGAAACCCTCCAAATCAACTGG + Intergenic
1121894148 14:97629937-97629959 CACACACACACACACTCCACTGG + Intergenic
1121922115 14:97891821-97891843 CAGAAACAAGCCCAGTGCACAGG + Intergenic
1122132432 14:99612680-99612702 CAGAAACACCCCCATATCACGGG - Intergenic
1123034286 14:105465607-105465629 CTGAGCCACGCCCACTCCACAGG + Intronic
1125590773 15:40853400-40853422 CAGACACACACCCACACCCCTGG - Intronic
1126899273 15:53295538-53295560 CAAAAAGACTTCAACTCCACAGG - Intergenic
1127659982 15:61091493-61091515 CACACACACTCCCACTTCCCAGG + Intronic
1127960450 15:63886715-63886737 CAGAAACACTGCCCATCCTCAGG + Intergenic
1128671042 15:69575012-69575034 CAGAGAGACTCCCATTTCACTGG - Intergenic
1128711582 15:69876166-69876188 CACACCCACTCCCACCCCACAGG + Intergenic
1128988737 15:72241074-72241096 CATAAACAGTCCCAATCCGCAGG + Intergenic
1131350239 15:91692892-91692914 CAGAACCACTCCCACTCCAGGGG - Intergenic
1139289415 16:65844027-65844049 CAGAAAGACTCCCAGCCCAGGGG - Intergenic
1139701456 16:68710437-68710459 CAGTAGCACCCCCACTCCAGTGG - Intronic
1140139801 16:72244884-72244906 CTGAAACTCTGCCACTCCAAGGG + Intergenic
1140164648 16:72537812-72537834 CAGAAACACAGCCATTCAACTGG - Intergenic
1146680258 17:34802183-34802205 CATAAAAACTCTTACTCCACAGG + Intergenic
1147317119 17:39626412-39626434 CAGACACACTCACACCACACCGG + Intergenic
1148284133 17:46372941-46372963 CGGATTCACTCCCACTCCTCTGG - Intergenic
1148306354 17:46590862-46590884 CGGATTCACTCCCACTCCTCTGG - Intronic
1148330835 17:46813032-46813054 CCCAAACACTCCCACTCTTCTGG - Intronic
1149606797 17:57930821-57930843 CACAAACAGTCCAACTCCAAAGG + Intronic
1151118459 17:71765770-71765792 CAGAATCAGGCCAACTCCACAGG + Intergenic
1151965678 17:77430050-77430072 CAGACACAGGCCTACTCCACAGG - Intronic
1152389859 17:79997118-79997140 CAGAACCACTCCCCCACCGCAGG - Intronic
1153764744 18:8364932-8364954 CAGCAACTCTCCCCATCCACAGG - Intronic
1157222053 18:45835570-45835592 CAGTCACTCTCCCACTCCAAGGG + Intronic
1160468225 18:79101172-79101194 CAGAACCATTCCAACCCCACAGG + Intronic
1160952184 19:1672925-1672947 CAGAAACACACCAACCACACAGG - Intergenic
1161156974 19:2737090-2737112 CAGAAACACCCCTCCTCCAAAGG + Exonic
1161473864 19:4473895-4473917 CAGAAGCGCTCCCACTCCCTGGG - Intronic
1164548040 19:29185358-29185380 CTGAAACACTGCCACAGCACTGG + Intergenic
1165407567 19:35640124-35640146 CAGTCCCACTCCCACTCCATGGG + Intergenic
1166148226 19:40851549-40851571 CCCAAACACTCCCTTTCCACTGG - Intronic
1166152368 19:40883334-40883356 CCCAAACACTCCCTTTCCACTGG - Intronic
1166177813 19:41087311-41087333 CCCAAACACTCCCTTTCCACTGG + Intergenic
1167813643 19:51858044-51858066 CAGATATGCTCCCACTGCACAGG + Intronic
1168125235 19:54279157-54279179 CACAAACCCTCCCTCTCCCCCGG + Intronic
925914733 2:8596508-8596530 CACACACACTCGCACTCCTCTGG - Intergenic
926370232 2:12171718-12171740 CCGATACACCCCCATTCCACAGG - Intergenic
926767145 2:16331337-16331359 CAGCAAAATTCCTACTCCACGGG + Intergenic
926812276 2:16765608-16765630 CAGAAACACCCACATTCCATGGG + Intergenic
929052234 2:37847701-37847723 CAGAAAGAGTCCTACTCCAGGGG - Intergenic
936431985 2:112472773-112472795 CAGGGACATCCCCACTCCACAGG + Intergenic
937300027 2:120833314-120833336 CAGAAACATTCCCCCTGCAGAGG + Intronic
940905458 2:159165337-159165359 GTGAAACCCTCCCATTCCACAGG - Intronic
941292373 2:163693243-163693265 CAGATACACACACACACCACAGG - Intronic
942944214 2:181656253-181656275 CAGAAACACTCCCAAAGCTCTGG + Intronic
944957236 2:204825986-204826008 TAGACTCACTCCCACTGCACGGG + Intronic
945265308 2:207885141-207885163 CCAAAACATTCCCACGCCACCGG - Intronic
945909908 2:215636540-215636562 CAGAGAGACTCCTACTCCAAAGG - Intergenic
946298711 2:218808486-218808508 CAGAAAAACTCCAACTTTACTGG - Intronic
946994169 2:225371965-225371987 CAGAATGACTACCTCTCCACTGG - Intergenic
948564627 2:238876091-238876113 CAGAAATCCTCCCAGTGCACCGG + Intronic
1169518606 20:6346043-6346065 AAGAAACACACCAACTCCAATGG + Intergenic
1169636199 20:7694704-7694726 CAGAAACACACCCTCCACACAGG + Intergenic
1170214584 20:13877778-13877800 TAGACACTCTCCCACTCCTCAGG - Intronic
1171423281 20:25033076-25033098 CAGAAACACTCCTGCTACTCCGG + Intronic
1173460297 20:43237847-43237869 CAGCAACAGGCCCACTCCTCTGG - Intergenic
1174002504 20:47385191-47385213 GAGAAACACACCCACGCCCCGGG - Intergenic
1175903919 20:62370722-62370744 CAGAAGCTCTCCCAGTCCGCTGG - Intergenic
1180154584 21:45971789-45971811 CAGGAACACTCACACTCCCTGGG - Intergenic
1181683443 22:24512273-24512295 CAGAGACACTCCGCCTCCACAGG + Intronic
949572039 3:5302791-5302813 GAGAAACTCTCCCACTCCCAGGG + Intergenic
949819543 3:8101187-8101209 AAGAGTCACTCCAACTCCACAGG + Intergenic
950696379 3:14704076-14704098 CACACACACTCCTACTCCATAGG + Intronic
951864894 3:27297297-27297319 CATAAATACTCTTACTCCACAGG + Intronic
952825324 3:37519965-37519987 CAGAGCCAGTGCCACTCCACAGG - Intronic
953037350 3:39224586-39224608 CAGAAATATTCCCACTGGACTGG + Intergenic
953160908 3:40417938-40417960 CAGAAACACACACATTCCATAGG - Intronic
953552955 3:43918587-43918609 CACACACACACACACTCCACTGG + Intergenic
953738719 3:45518075-45518097 CAGAAACTCTCCAATTCCAGGGG + Intronic
954391191 3:50268989-50269011 CACAGACACACCCACGCCACTGG - Intronic
955760908 3:62281308-62281330 CTGAAACACTCCCACTATAGGGG - Intronic
956129531 3:66039923-66039945 CAGAAAGACTCCCATACCACAGG + Intergenic
956667852 3:71658838-71658860 CACACACACTCCCACTGCACTGG + Intergenic
957772284 3:84709426-84709448 CAGACACACTCTCAGACCACAGG + Intergenic
958948181 3:100388340-100388362 CAACAATCCTCCCACTCCACTGG + Intronic
961358331 3:126352561-126352583 CAGAAATGCTCCCCCTTCACAGG + Exonic
965961768 3:174437765-174437787 CAGACACACACACACTCCATGGG - Intergenic
966076511 3:175941468-175941490 CAGCATCACTCCCACACCTCAGG + Intergenic
967958708 3:194901049-194901071 GAGAACCACTCCCAATCCCCCGG - Intergenic
969226557 4:5802296-5802318 TTAAAACACTCCCACTGCACTGG - Intronic
969456234 4:7301290-7301312 CAGAAACACTGCCACTCTCATGG + Intronic
969899441 4:10335347-10335369 CAGAGAGGCTCCCACTTCACAGG - Intergenic
969946002 4:10783704-10783726 AACAAACACTCCCACTCCCATGG - Intergenic
970851152 4:20604716-20604738 TAGTATCACTCCCACTTCACAGG + Intronic
974185153 4:58435889-58435911 CAGACACAAACCCTCTCCACTGG + Intergenic
976699006 4:87948979-87949001 TAAAGACATTCCCACTCCACAGG - Intergenic
979697079 4:123624726-123624748 CAGAAATACCCCCACTCCTGGGG + Intergenic
980009716 4:127581547-127581569 CAGAAACATAGCCACTCTACTGG + Intergenic
981448974 4:144873734-144873756 CAGGAAGACTCACAGTCCACAGG - Intergenic
981995142 4:150966008-150966030 CAGAAACAATACCATCCCACAGG + Intronic
982404384 4:155003722-155003744 CAGGAACACACCACCTCCACCGG - Intergenic
983279759 4:165665499-165665521 CAGAAACACTCCCACAACCAAGG - Intergenic
984878105 4:184387253-184387275 CTAAAATACTCCCCCTCCACAGG + Intergenic
986707678 5:10465029-10465051 GAGAAACACTCACACTACAGAGG - Intronic
986806264 5:11311533-11311555 CACACACACTCTCACCCCACAGG + Intronic
988198572 5:28041223-28041245 TTGAAACTCTCCCACTCTACTGG - Intergenic
988541494 5:32114016-32114038 CAGAAACATTCCCATTCGTCAGG + Intergenic
990890369 5:60642323-60642345 CAGAAACACTACCATTCTTCTGG - Intronic
992943457 5:81786200-81786222 CAGAAAGTCTCCTACTACACAGG + Intergenic
997210136 5:132072335-132072357 CAGAAAAACTCCCACAGTACAGG + Intergenic
998511089 5:142714499-142714521 CAGAAACATTTTCCCTCCACTGG - Intergenic
1000125775 5:158242426-158242448 AAGAAATACTGACACTCCACAGG - Intergenic
1006116131 6:31777056-31777078 CAGAAACACTCCCCATGCTCAGG + Intronic
1007292637 6:40798877-40798899 CACAAACACTCCCATTCCTGAGG + Intergenic
1007843791 6:44737830-44737852 CAGCATCACTCCCACCCCTCCGG + Intergenic
1009781710 6:68279962-68279984 CACATACACTCCAAGTCCACTGG - Intergenic
1014104656 6:117548179-117548201 CACAAACACTCCCTCTCCTCGGG + Intronic
1014640342 6:123901257-123901279 CAGAAACAGTGCTACTTCACTGG - Intronic
1016121000 6:140340896-140340918 CAGTAACACTCCCAAACAACAGG - Intergenic
1017786490 6:157761183-157761205 CAGACCCACCCCCACACCACTGG + Intronic
1019323917 7:428739-428761 CACAGACACTCCCACTGGACAGG + Intergenic
1021609488 7:22443804-22443826 CAAAAACACTTCCACTCGGCTGG + Intronic
1021625221 7:22586493-22586515 CTGACACACTCCAGCTCCACAGG + Intronic
1022114556 7:27250620-27250642 CAGAAACAATGCCACTCTTCAGG + Intergenic
1026104199 7:67408072-67408094 AACATTCACTCCCACTCCACTGG - Intergenic
1030380871 7:108810542-108810564 CAGTAACACTCCCAGTCCAATGG + Intergenic
1030703728 7:112669198-112669220 GAGGAACACTCCCACTCCCAGGG - Intergenic
1031815682 7:126432116-126432138 TAGAGACACTCCCATTCAACTGG - Intergenic
1036411049 8:8501808-8501830 CACAAACACACACACCCCACAGG + Intergenic
1037419094 8:18683008-18683030 CAGAAACACTCCCACTCCACAGG - Intronic
1037829708 8:22180240-22180262 CAGACACCCTCCCACTCCTCAGG + Intronic
1037947879 8:23000412-23000434 CAGAATCACTCCCACCACTCTGG - Intronic
1038525252 8:28267586-28267608 GAGCAACCCTCCCTCTCCACAGG + Intergenic
1041954020 8:63537344-63537366 CAGAAATACTCCAACTGCACAGG + Intergenic
1048876727 8:138842505-138842527 CAGACACATTCACACTCCAGTGG + Intronic
1052023781 9:23553293-23553315 TAGAAACATTCCCTCTCCATGGG + Intergenic
1053918944 9:42969787-42969809 CAGACACACACACACTCCAGTGG - Intergenic
1061080300 9:128365761-128365783 CAGAGACACTCCCTCCCTACTGG - Intergenic
1187065969 X:15838279-15838301 CTGCACCACTCCCACTCCATGGG + Intronic
1187425071 X:19170408-19170430 CAGGAACACTCCCTCTTCCCAGG + Intergenic
1190039215 X:47055929-47055951 CAGAATGAGACCCACTCCACAGG - Intronic
1190829290 X:54045471-54045493 CAGATGCCCTCCCACTCCAGAGG - Intronic
1190980464 X:55452840-55452862 CAGAAGAACTCATACTCCACCGG - Exonic
1192989095 X:76429872-76429894 CAGAAAAACTCATACTCCACTGG - Exonic
1194012993 X:88584793-88584815 CAGAAACAGTACCACTGGACTGG - Intergenic
1194561840 X:95431172-95431194 CTGAAACCATCCCCCTCCACGGG - Intergenic
1194998957 X:100623368-100623390 CAGAATCACTCCTACTCTTCAGG - Intergenic
1200379462 X:155819685-155819707 CATATGCACTCCCATTCCACTGG - Intergenic