ID: 1037419100 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:18683037-18683059 |
| Sequence | CTGCTCACACAGATGGTGGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1037419094_1037419100 | 6 | Left | 1037419094 | 8:18683008-18683030 | CCTGTGGAGTGGGAGTGTTTCTG | 0: 1 1: 0 2: 1 3: 19 4: 176 |
||
| Right | 1037419100 | 8:18683037-18683059 | CTGCTCACACAGATGGTGGTGGG | No data | ||||
| 1037419091_1037419100 | 17 | Left | 1037419091 | 8:18682997-18683019 | CCATTTTTAAACCTGTGGAGTGG | 0: 1 1: 0 2: 1 3: 8 4: 150 |
||
| Right | 1037419100 | 8:18683037-18683059 | CTGCTCACACAGATGGTGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1037419100 | Original CRISPR | CTGCTCACACAGATGGTGGT GGG | Intronic | ||
| No off target data available for this crispr | |||||