ID: 1037419100

View in Genome Browser
Species Human (GRCh38)
Location 8:18683037-18683059
Sequence CTGCTCACACAGATGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037419094_1037419100 6 Left 1037419094 8:18683008-18683030 CCTGTGGAGTGGGAGTGTTTCTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1037419100 8:18683037-18683059 CTGCTCACACAGATGGTGGTGGG No data
1037419091_1037419100 17 Left 1037419091 8:18682997-18683019 CCATTTTTAAACCTGTGGAGTGG 0: 1
1: 0
2: 1
3: 8
4: 150
Right 1037419100 8:18683037-18683059 CTGCTCACACAGATGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037419100 Original CRISPR CTGCTCACACAGATGGTGGT GGG Intronic
No off target data available for this crispr