ID: 1037422949

View in Genome Browser
Species Human (GRCh38)
Location 8:18723592-18723614
Sequence CTGGAGATACAGAAGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 393}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037422949_1037422957 12 Left 1037422949 8:18723592-18723614 CCCTGTTCCTTCTGTATCTCCAG 0: 1
1: 0
2: 3
3: 43
4: 393
Right 1037422957 8:18723627-18723649 CGAGGCCTTCCATACACTAATGG No data
1037422949_1037422952 -6 Left 1037422949 8:18723592-18723614 CCCTGTTCCTTCTGTATCTCCAG 0: 1
1: 0
2: 3
3: 43
4: 393
Right 1037422952 8:18723609-18723631 CTCCAGTACCATCTCTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037422949 Original CRISPR CTGGAGATACAGAAGGAACA GGG (reversed) Intronic
900753767 1:4418761-4418783 CTGGAAATACAGGATGCACAAGG + Intergenic
900779128 1:4606144-4606166 CAGCAGATACAGCAGGTACAGGG - Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
904821921 1:33251103-33251125 CTGAAGGGACAGAAAGAACAGGG + Intergenic
904949913 1:34228608-34228630 CTGGAGAGCAACAAGGAACAAGG - Intergenic
906033330 1:42736604-42736626 CTGAAGGCAGAGAAGGAACAGGG - Intronic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908376960 1:63553203-63553225 GTGGAGATAAGGAAGGATCATGG + Intronic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909056340 1:70825522-70825544 CTGCAGATAGAGATGGAATAAGG + Intergenic
910460302 1:87441927-87441949 CTGGAGAGGAAGAAGGATCAAGG + Intergenic
911697146 1:100902635-100902657 CTGAAGCTACAGAAAGATCATGG - Intronic
912046292 1:105462855-105462877 CTGGAGATATGTAAGGAAAACGG + Intergenic
912555858 1:110515569-110515591 CTGGAGATTCAGGAGCACCATGG - Intergenic
912736402 1:112153013-112153035 CTCCAGATACAGAGGGGACAGGG + Intergenic
914505652 1:148286902-148286924 CTGCAGATACAGTGGGAAAATGG + Intergenic
914506904 1:148297249-148297271 CTGCAGATACAGTAGGAAGATGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915723385 1:158000486-158000508 CTGGAGCTACAGAATGGAGAGGG - Intronic
915932128 1:160067380-160067402 CTGGAGAGACCGAAGTGACATGG + Intronic
916015987 1:160750328-160750350 CAGGAGACACAGGAGGACCATGG - Exonic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916544584 1:165791378-165791400 CAGGAAATACAGAGGGTACAGGG + Intronic
916849575 1:168689820-168689842 CTGGAGAAACAGAAGGCATTAGG - Intergenic
918386423 1:184012929-184012951 CTGGAGATTCAAAAAGAAGAGGG + Intronic
919046716 1:192461885-192461907 GTGGAGATCTAGAAGGAGCATGG + Intergenic
921633915 1:217468800-217468822 GTGGGGATACAGATGAAACAGGG + Intronic
923613629 1:235518007-235518029 CTCAACATACAGAATGAACAAGG - Intergenic
1064272345 10:13877208-13877230 CTTGACATACAGTAGGAAAATGG + Intronic
1065666671 10:28070706-28070728 CTGGACATATATAAGGAGCAAGG + Intronic
1065913023 10:30326814-30326836 CTGGAGAAACAGAAGGCAACTGG - Intronic
1066056056 10:31681247-31681269 TTGGAGATACAGAAAGAATTTGG + Intergenic
1067211551 10:44263786-44263808 GTGTAGATACAGGAGGAAGATGG + Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068635184 10:59340526-59340548 ATGGAGAGTCCGAAGGAACAAGG - Intronic
1070588775 10:77786815-77786837 CTGAAGCTCCAGAAAGAACAGGG + Intergenic
1071350346 10:84734460-84734482 CTGGAGATACTGATGGTACCAGG - Intergenic
1072191797 10:93081829-93081851 CTGGAGAAACATAAGGTAAATGG - Intergenic
1072694777 10:97595074-97595096 CTGGGGACACATAAGCAACATGG - Intronic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1074723716 10:116286060-116286082 CTGGGGATACAACAAGAACATGG - Intergenic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1077213578 11:1384607-1384629 CTGTAGCTACAGAAGGCAGAGGG - Intergenic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078798014 11:14612987-14613009 ATGGAGATAGGGAAGGAACATGG + Intronic
1078827494 11:14943366-14943388 CTGGATATAAAACAGGAACATGG - Intronic
1079145680 11:17849554-17849576 CTGTAGATATAGAAGGTACAAGG - Intronic
1079188728 11:18260090-18260112 CTGGAGAGAATGAAGGGACAAGG - Intergenic
1079531753 11:21462669-21462691 CTGGAGCTGCAGGATGAACAAGG - Intronic
1080392306 11:31859789-31859811 CTGGAGATAGTGAATCAACATGG - Intronic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1081095270 11:38924971-38924993 AGGGAGATAGAGAAGGAAGAAGG - Intergenic
1081907513 11:46679076-46679098 TTGGTGATCCAGAAGGAACTTGG + Exonic
1082833160 11:57634348-57634370 CTGGAGATTCAGTGGGAACCTGG - Intergenic
1082869186 11:57928256-57928278 CTGGGAATAAAGAAGGAATAAGG + Intergenic
1083048123 11:59754862-59754884 CTGGAGATACAGGACGGTCAGGG - Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1085956280 11:81400076-81400098 CTGGAAATACTGAACAAACAAGG - Intergenic
1088386817 11:109267648-109267670 TTGCAGATACAGAAGCAATAGGG - Intergenic
1089633318 11:119796778-119796800 CTAGAGACCCAGGAGGAACAGGG - Intergenic
1089861406 11:121593212-121593234 CTGCAGAAACACAAGGTACATGG - Intronic
1090927564 11:131262026-131262048 CTGGGGATACAGAATGAATAAGG + Intergenic
1092027953 12:5258829-5258851 CTAGAGAAACAGAACTAACAGGG - Intergenic
1093514028 12:19964415-19964437 CAGGAGTTACATAAGGGACAAGG - Intergenic
1093784577 12:23177313-23177335 CAGGAGATACAGAATCAGCAGGG - Intergenic
1095109301 12:38274470-38274492 CTGGAGGTGGAGAAGGAACAAGG + Intergenic
1096682770 12:53268028-53268050 CTGAAGATAAAGGAGGAAAAGGG + Intergenic
1096889993 12:54760171-54760193 CTGGAGATAAAGAGGGAAAGTGG - Intergenic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1097606340 12:61759075-61759097 CTTGAAATACAGAAGGAAGCTGG - Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1100245610 12:92753711-92753733 CTGGAGAGGCAGAAGGGAAAAGG - Intronic
1101059891 12:100959820-100959842 ATGGAGATACAGAAGAAAAGGGG - Intronic
1102570164 12:113822647-113822669 CTGGAGGGAGAGCAGGAACAGGG + Intronic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103024387 12:117561936-117561958 CTGGAGATTCACAATGAACAAGG + Intronic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1105503797 13:20993069-20993091 GTGGAGATACAGAAAGACCCCGG + Intronic
1105985401 13:25561278-25561300 CAAGAGATGCAGAGGGAACAGGG - Intronic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1109706746 13:66104065-66104087 TTGGATATGCAGAATGAACAAGG - Intergenic
1111667679 13:91290344-91290366 CTGGAGATGTAGAACCAACAGGG - Intergenic
1112169184 13:96951939-96951961 CTGAAGATATATAAAGAACATGG + Intergenic
1112212182 13:97388720-97388742 CTGGAGATATAGACAGAACAGGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113587583 13:111475845-111475867 CTAGAGATACAGGAGCAAGATGG - Intergenic
1114192070 14:20447282-20447304 GTGGAAAAACAGAAGAAACATGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115331099 14:32199402-32199424 TTGGAGATAAAGAAGAAACAAGG - Intergenic
1115721000 14:36161524-36161546 CTGGAGATACCCAGGCAACAGGG - Intergenic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1116721038 14:48495820-48495842 TTGCTGATACAGAATGAACAAGG - Intergenic
1118156605 14:63248683-63248705 GTGGAGCCACAGAATGAACAAGG + Intronic
1118730801 14:68664974-68664996 CTGAAAGGACAGAAGGAACATGG - Intronic
1119134916 14:72208581-72208603 CTGGAGATACAAAGGGAAATAGG - Intronic
1119427511 14:74545457-74545479 CTGGAGATACAGAGGGCCCTGGG + Intronic
1119473312 14:74912427-74912449 CTGGAGGTCCAGTTGGAACAGGG - Intronic
1119884216 14:78126759-78126781 CAGGAGAGACAAAAGGCACAGGG - Intergenic
1120034531 14:79681303-79681325 CAGGAGATCCAGGAAGAACAGGG - Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1121010809 14:90519048-90519070 CAGAAGACACAGAAGGCACAGGG - Intergenic
1122154549 14:99742378-99742400 CTGGGGATGGAGAAGGTACATGG + Intronic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1124100695 15:26690083-26690105 CTGGAGAATGAGAAGGTACACGG + Intronic
1124557798 15:30744081-30744103 TTGGAGATAGAGAAGAAGCATGG + Intronic
1124673438 15:31661575-31661597 TTGGAGATAGAGAAGAAGCATGG - Intronic
1125244167 15:37615240-37615262 CTGGTGATTCAGAAGTAATAGGG + Intergenic
1125747747 15:42008644-42008666 CTGGAGCAACAGAAGGGATAGGG + Intronic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1126932490 15:53670508-53670530 CTGGACAGATAGAAAGAACATGG - Intronic
1127155324 15:56118369-56118391 ATGGAGATACAGTAGGATGATGG - Intronic
1129308641 15:74688291-74688313 CAGGAGATACAGGAGCTACAAGG + Intronic
1130361063 15:83186717-83186739 CTGGAGATTCAGAAGGGAAGAGG + Intronic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1132384915 15:101393425-101393447 CTGGAGGGACAAGAGGAACAAGG + Intronic
1134208154 16:12254158-12254180 ACGGAGAGACAGAAGGAACGTGG + Intronic
1134304759 16:13022110-13022132 ACGCAGATACAGAAGGAACAAGG - Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135459111 16:22626115-22626137 CTAGAGAAACAGAACCAACAGGG + Intergenic
1135727858 16:24870838-24870860 CTAGAGATGCAGAAGAAAGATGG + Intronic
1135871301 16:26153256-26153278 CTGGAGATACAGAAAGATGGCGG + Intergenic
1135892527 16:26370504-26370526 CTGGAGATAAAGATGACACAGGG - Intergenic
1135972226 16:27080857-27080879 CTGAAGAGAGAGAAGGAAAAGGG - Intergenic
1137398063 16:48131140-48131162 CTGTTGATACAGAAGGGAAAAGG + Intronic
1137879886 16:52034996-52035018 TTGGAGGTACAGCTGGAACAGGG - Intronic
1138273190 16:55710636-55710658 CTGGAGTTCCAGGAGGACCAAGG + Intergenic
1138881912 16:61026966-61026988 ATGGAGATAGTGAAGGAAAAGGG + Intergenic
1140182971 16:72738726-72738748 CTGGAGATACTGAAAGGACCTGG + Intergenic
1140361569 16:74348883-74348905 CTGGAGATTCAGAATCTACAGGG - Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1141450009 16:84092907-84092929 CTGGAGGTAGAGAAGAAACAAGG + Intronic
1141881765 16:86864944-86864966 CTGGAGATTAGAAAGGAACAAGG + Intergenic
1145102831 17:20090920-20090942 CTGGAGACCCATAAGGAATAGGG - Intronic
1145392029 17:22462442-22462464 CAGGAGCTTCAGAAGGCACATGG - Intergenic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1148514334 17:48201758-48201780 CTGGAGATAGATAAGGTCCAAGG - Intronic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1149004606 17:51792277-51792299 ATGGAGATGGAGAAGCAACAGGG - Intronic
1149411911 17:56417429-56417451 CTTGAGAAACAGCAGGGACAAGG - Intronic
1149442751 17:56688952-56688974 GTGAAGTTACAGAAAGAACAAGG + Intergenic
1150665319 17:67130165-67130187 CTGGAGATTCAGAAGGTAGCGGG + Intronic
1152260454 17:79263953-79263975 CTTGAGACACACAAGGAAGAAGG + Intronic
1153211717 18:2773955-2773977 GTAGAAATACAGTAGGAACAAGG + Intronic
1154057982 18:11029898-11029920 CAGAAGATAAAAAAGGAACATGG - Intronic
1154505650 18:15038245-15038267 CTTGAGAAACAGAAGGACCAAGG - Intergenic
1155246392 18:23914277-23914299 TTGGAGAGACAGAATAAACAAGG - Intronic
1155503423 18:26509801-26509823 CTTCAGATTCCGAAGGAACAGGG - Intronic
1155660846 18:28246605-28246627 CTGGAGCAACAGCATGAACAGGG + Intergenic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156850681 18:41722323-41722345 CTAGAGAAACACAAGGACCATGG + Intergenic
1157400226 18:47381155-47381177 CTGGATATGCTGAATGAACATGG + Intergenic
1157656209 18:49391646-49391668 CTGGAGAGACAGAAGAATAAAGG + Intronic
1159722792 18:71914019-71914041 ATGCAGATACACAAGGACCAAGG - Intergenic
1160359643 18:78262459-78262481 TTAGAGATCCAGAAGGAAAAGGG + Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1161841020 19:6680341-6680363 GTGGAGAAACTGAAGGATCAAGG + Intronic
1162148807 19:8630709-8630731 CTGGAGAGCCAGGAGGAGCAAGG + Intergenic
1162833331 19:13300331-13300353 CTGGGGATACAGCATTAACAAGG - Intronic
1162991854 19:14308106-14308128 CTGGACAGACAGAAAGAACCTGG + Intergenic
1163129996 19:15266378-15266400 CTTGAGATGCACAGGGAACATGG - Intronic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1165560319 19:36673717-36673739 CTAGAGAAACAGAACAAACAGGG - Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166384990 19:42375874-42375896 CTGGGGATCCAGGAGGAGCAGGG + Exonic
1167096905 19:47379526-47379548 CTGGGGATACGGCATGAACAAGG - Intronic
1168111854 19:54196869-54196891 CTGGGGATACTGCATGAACAAGG - Intergenic
1168190339 19:54733823-54733845 ATGGAGATACAGATAGATCATGG + Intronic
1168207483 19:54861953-54861975 GTGGAGATACAGATAGATCATGG + Intronic
925571867 2:5321122-5321144 CAGGAGATGAAGGAGGAACAAGG - Intergenic
925591805 2:5517285-5517307 CAGGAGGTAGAGAAGGAATAAGG + Intergenic
925693360 2:6548396-6548418 CTGGAGAGAAAGAAAGAAAAAGG + Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926270727 2:11364166-11364188 CTGGGGATACAGAAGCAAGTAGG + Intergenic
926318977 2:11734950-11734972 TTGACGAGACAGAAGGAACAAGG + Intronic
926702811 2:15815114-15815136 CTGGTGAGACAGAAGGCACGTGG - Intergenic
926769960 2:16362161-16362183 CTGAAGATAGAGAATGAATAAGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927123001 2:19986029-19986051 CTGGAGCTATAGAGGGAGCAGGG + Intronic
927932845 2:27056573-27056595 AAGGAGAGACAGAAGGGACAAGG - Intronic
928394920 2:30936185-30936207 ATGGAGAGACAGAAGGAAAGTGG - Intronic
928650464 2:33398643-33398665 CTGGAAATACAGAAACAGCATGG + Exonic
929247280 2:39716366-39716388 TTGGAGTGACATAAGGAACATGG - Intronic
929560106 2:42951165-42951187 CTGGAGTTGGAGAAGGCACAGGG + Intergenic
930003397 2:46877232-46877254 ATGGAGAGACAGAAGCCACATGG - Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
930028121 2:47042014-47042036 CTGGAGCTACAGAAAGGAAAAGG + Intronic
930028764 2:47045694-47045716 CTGGAGATACACAAAGAAGGCGG - Intronic
930303060 2:49641456-49641478 CTGAAGATATAGAAGTAAAATGG - Intergenic
930775546 2:55166750-55166772 CTGAAGATACAAAGGGATCAAGG + Intergenic
931883104 2:66587505-66587527 CTGGAGCTATGGAAGGAATAAGG + Intergenic
932703302 2:74004976-74004998 CTGGAGATACAGAGGAGAGAGGG - Intronic
932717439 2:74111818-74111840 CTTAAGGTACAGAAGAAACAGGG - Intergenic
933588270 2:84203246-84203268 CAGGAGAGACAGAAAGAAAATGG + Intergenic
933729317 2:85445242-85445264 CCGGAGATAAAGAAGGTACCAGG + Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
936082804 2:109446490-109446512 CTGGAGCTAGAGCAGGAGCAGGG + Intronic
936618898 2:114074859-114074881 ATGCAGGTACAGAAGGATCAGGG + Intergenic
937090698 2:119204539-119204561 CTGGAGAGACAGGGAGAACAGGG + Intergenic
937909061 2:127066595-127066617 CTGGAGGTAGAGGAGGAACCAGG - Intronic
938504840 2:131868513-131868535 TTTGAGAAACAGAAGGACCAAGG - Intergenic
938620747 2:133050132-133050154 CTACAGATATAGAAAGAACATGG - Intronic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
938966680 2:136394778-136394800 CTGGAGGAACAGAAAGTACAGGG + Intergenic
940390153 2:153123044-153123066 GTGAAGATACAGAAGACACAGGG + Intergenic
940390159 2:153123112-153123134 ATGAAGATACAGAAGACACAGGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
942946923 2:181682540-181682562 CTGAAGATACAGACAGTACAGGG - Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943834659 2:192503626-192503648 CTGGAGATAAGGGAGGAAGAAGG + Intergenic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
1170108439 20:12778293-12778315 CTGGAGATACAGCACGCTCAGGG + Intergenic
1170147443 20:13192234-13192256 TTGGAGGTACATAAAGAACAGGG + Intergenic
1172648243 20:36484757-36484779 CTGGAGCCCTAGAAGGAACAAGG + Intronic
1173583206 20:44161886-44161908 CTGGAGCTACCGAAGGGAGAGGG - Intronic
1175480236 20:59305455-59305477 CTAGAGAGACAGAACCAACAGGG + Intronic
1175482828 20:59323479-59323501 CTGGGGACATAGCAGGAACAAGG + Intronic
1176792211 21:13330871-13330893 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1176893640 21:14349893-14349915 CGGGACAGACAGAAAGAACAGGG - Intergenic
1176916590 21:14633235-14633257 CTAGAGAAACAGAAGTAATAGGG - Intronic
1176925374 21:14743205-14743227 CTTCAGATTCAGAGGGAACAAGG + Intergenic
1177300438 21:19237437-19237459 CTGAAGAAACTAAAGGAACATGG - Intergenic
1177991606 21:28041735-28041757 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1179110849 21:38443843-38443865 CTGGAGTTACAGAAGGACCTGGG - Intronic
1181401946 22:22654911-22654933 GTAGACATACAAAAGGAACATGG + Intergenic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182371448 22:29814144-29814166 CTGGAGATAGAACAGGAACAAGG - Intronic
1183119645 22:35720545-35720567 CTGGAGATGGACAAGGATCAGGG - Intronic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
1185066659 22:48635651-48635673 CTGCAGACACAGGAGGAACCAGG - Intronic
1185129196 22:49028092-49028114 ATGGAGGTACAGAAGGAAGGAGG + Intergenic
949432108 3:3988523-3988545 TTTGAGATACTGAAGGAAAAAGG - Intronic
949490260 3:4582312-4582334 CTACAGACACAGTAGGAACATGG - Intronic
950184300 3:10935590-10935612 CAGGAGATACAGCAGGTAGACGG - Intronic
950483057 3:13256651-13256673 CTGGGGATGCAGAAGGGACCAGG + Intergenic
951331539 3:21374985-21375007 CTAGAGGTAAAGAAGGAAAAAGG + Intergenic
951539092 3:23765433-23765455 CTAGAGACACTGAACGAACAGGG + Intergenic
951643735 3:24864586-24864608 CTAGCAATAAAGAAGGAACAAGG - Intergenic
951680337 3:25288232-25288254 CTGGAGAGAAAGGAGGAAAATGG + Intronic
952768520 3:36976471-36976493 CTGGAGGTTCAGCAGGGACAAGG - Intergenic
953409479 3:42682245-42682267 GTGGAGATAGAGATGAAACAGGG + Intergenic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
953994694 3:47510833-47510855 CTCGAGATACACAAAGACCAAGG + Intronic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954150107 3:48653057-48653079 CTGGAGTTGCAGGAGGAACCAGG - Exonic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
955317680 3:57952396-57952418 CTACAGATACACAAGGAAGATGG - Intergenic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
956142097 3:66156273-66156295 CTGGGGTTACAGCAGTAACAAGG + Intronic
956633243 3:71336865-71336887 CAGGAGATAGAGAAGGCAGAGGG + Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959585551 3:108022060-108022082 CTTGAGACAGAGTAGGAACAAGG + Intergenic
960911919 3:122657849-122657871 CTAGAGAAACAGAACCAACAGGG + Intergenic
961071722 3:123936038-123936060 CTGCAGATACAGAAGATAAAGGG - Intronic
962031477 3:131605382-131605404 CTAGAGAGAGAGAAGGAAGAGGG - Intronic
963042842 3:141081991-141082013 TTGGGGATACAGGAGGGACATGG - Intronic
963971491 3:151435033-151435055 CTCAAGATACAGAATTAACAGGG - Exonic
965356169 3:167675596-167675618 CTGGTGATATATAAAGAACAAGG + Intergenic
965869047 3:173244668-173244690 ATTGAAATACAGAAGGAAAAAGG - Intergenic
966636865 3:182144784-182144806 CTGGAGATACAGAAGTTTCTGGG + Intergenic
967944118 3:194788679-194788701 CTAGAGAAACAGAACCAACAGGG + Intergenic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969133631 4:5012019-5012041 CAAGAGATACAGAGGAAACAGGG + Intergenic
969141275 4:5076004-5076026 CTGGAGATGCTGAATTAACATGG + Intronic
969377250 4:6771144-6771166 CTGGGCATACAGCAAGAACATGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
973965266 4:56155430-56155452 CTGGGGATACATGAGGAACCAGG + Intergenic
974465876 4:62255330-62255352 CTGCAGTTACAAATGGAACAGGG + Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
975402039 4:73949757-73949779 CTGGAGAGACAGAAAGTATAAGG + Intergenic
976539994 4:86263190-86263212 CAGGATATAGAGAAGTAACAAGG - Intronic
977322826 4:95540535-95540557 GAGGAGATCCAGAAGGAAAAAGG + Intronic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
978315449 4:107430788-107430810 CTGGAGGTACAGGAGGGAAAGGG - Intergenic
978603994 4:110459249-110459271 ATGGAGAAACGGAAGGAACTAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981390782 4:144189232-144189254 CTGGTGGTCTAGAAGGAACAGGG - Intergenic
981933828 4:150218113-150218135 CTTGAGCCTCAGAAGGAACAGGG - Intronic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
984760688 4:183360211-183360233 CTCTAGATACAGAAGGTTCAAGG - Intergenic
986252705 5:6075351-6075373 ATGAAGATAAAAAAGGAACATGG + Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986503576 5:8427170-8427192 CATGAGATTCAGAAGGAACTGGG + Intergenic
987077117 5:14394035-14394057 CAGGAGATACAGCAGCGACATGG + Exonic
987268729 5:16282665-16282687 CTAGAGATACAGGAAGAAGAAGG + Intergenic
987929048 5:24379772-24379794 CTGGAGATAAAGAAAGAATAGGG - Intergenic
988025001 5:25674140-25674162 CAGGAGAGAGAGAATGAACAGGG + Intergenic
989076573 5:37569943-37569965 CTGGAAATACAGAAGAAATAGGG + Intronic
990211932 5:53490213-53490235 CAGGAGATACTGGGGGAACAGGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992571188 5:78059303-78059325 CTAGAGCTCCAGAAGGAACATGG + Intronic
993042679 5:82833360-82833382 TTGAAGTTACAGAAAGAACAGGG + Intergenic
993630631 5:90281998-90282020 CTGGAGCTAAAGAGGGCACATGG - Intergenic
993715957 5:91276091-91276113 CCAGAGTTTCAGAAGGAACATGG + Intergenic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
997202239 5:132017978-132018000 CTGGAGAGAGAGAGAGAACAGGG + Intergenic
999327893 5:150654698-150654720 ATGGAGATACAAAAGGAAGTCGG - Intronic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999478159 5:151920881-151920903 CTGGAGATGGAGAAGCCACAGGG + Intronic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1000393489 5:160749085-160749107 CTGGAGTCGCAGAAAGAACATGG - Intronic
1003192078 6:3883116-3883138 CAGGAGGCACAGAAGGCACAGGG - Intergenic
1003690735 6:8351375-8351397 CTGGAGGTACTGCAGGGACACGG + Intergenic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1005885080 6:30091465-30091487 GTGGAGAAACAAAAAGAACAAGG + Intergenic
1006285473 6:33090556-33090578 CAGGAGATTCAGAACGAAAAGGG + Intergenic
1006370173 6:33639426-33639448 GAGGAGGTACAGAAGGAGCACGG + Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006918134 6:37609276-37609298 CTGGAGATACTCAGGAAACAAGG - Intergenic
1007330758 6:41105969-41105991 CTGGAGATACAGGAGAAATTTGG + Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1008826699 6:55703138-55703160 CTGCAGATAGAGAAGGACTAGGG - Intergenic
1011043546 6:83057380-83057402 CTGGGGATACAGAGTGAACAAGG - Intronic
1011162132 6:84403295-84403317 TTGGAGGTCCAGAAGGAACTTGG + Intergenic
1011275260 6:85625119-85625141 CTGGAGATGGGGAAGGGACAGGG - Intronic
1011344951 6:86358848-86358870 TTGGAAATAGAGAAGGAAAAGGG + Intergenic
1011829344 6:91352248-91352270 TTGGAGATAGAGGAGAAACAAGG + Intergenic
1012333429 6:98023075-98023097 AAGGAGATGCAGAAGGAATATGG - Intergenic
1012517171 6:100075795-100075817 CTAGAGAAAGAGAAGGAACTGGG + Intergenic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1013976726 6:116087632-116087654 GAGAAGATACAGAAGGAACAGGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014720404 6:124911259-124911281 CTGGAGAGACAGGAGCCACAAGG + Intergenic
1014986850 6:128021778-128021800 CTGGAGTTTTAGAAGGAGCAAGG + Intronic
1015714748 6:136180917-136180939 GTGGAGCTACAGAAGGAGCCAGG + Intronic
1016029475 6:139322767-139322789 CTACAGAAAAAGAAGGAACAAGG - Intergenic
1016223505 6:141705527-141705549 CTGGAGATACAGAAATGAAAAGG - Intergenic
1016927446 6:149365717-149365739 TTGGAGATTCAGAAGGAAAGGGG - Intronic
1016961450 6:149676151-149676173 CTGGAGTTAAAGAATGAACTTGG - Intronic
1016996237 6:149964069-149964091 CGGGAGGCACAGAAGGAACGCGG - Exonic
1018031011 6:159841750-159841772 CAGGAGACATAGTAGGAACAGGG - Intergenic
1018575478 6:165255445-165255467 TTGGAGATATGGAAGAAACATGG + Intergenic
1018592887 6:165446817-165446839 CGGGAAAGAAAGAAGGAACAGGG + Intronic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018787646 6:167120935-167120957 TTGGAACTACAGAAGGAATATGG + Intergenic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1021297779 7:18930167-18930189 CTGGACATAGAGATGGAACGGGG - Intronic
1021445636 7:20730885-20730907 CTAGTTATACAGAAGGAACGGGG - Intronic
1021662499 7:22934362-22934384 CTGGAGAAACAAAAAGAACAGGG - Intergenic
1022033314 7:26512224-26512246 CTGAAGGTACTGAAGGAAGACGG + Intergenic
1023598616 7:41858692-41858714 ATAGAGATACAGAAGGCACAGGG - Intergenic
1024137021 7:46419724-46419746 TTGGAGATACAGCAATAACAGGG + Intergenic
1024499032 7:50082472-50082494 TAGGAGATACAAAAGGAACCCGG + Intronic
1024846755 7:53653566-53653588 ATAGACATACAGAAGGAAGAAGG - Intergenic
1025969606 7:66309955-66309977 CCTGAGATACAGAAAGAATAGGG + Intronic
1026095670 7:67344610-67344632 CTGGAGATGCAGCATGAGCAAGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026918466 7:74137737-74137759 TTGCAGATACAGAAAGAATAGGG + Intergenic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1027536572 7:79410513-79410535 GTGGAAGTACATAAGGAACAGGG + Intronic
1027732225 7:81888935-81888957 GTGGAGATACAAAAGGAAGCTGG + Intergenic
1030265053 7:107611778-107611800 ATGCAGCTATAGAAGGAACATGG + Intronic
1031345307 7:120658248-120658270 TTGAAAATACAGCAGGAACAGGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032543166 7:132721148-132721170 CTGGTGATTCAGAAGGAAGCAGG - Intronic
1032592268 7:133202707-133202729 CCATAGATGCAGAAGGAACAGGG + Intergenic
1033236202 7:139639696-139639718 CTGGAGATACAGCAGTGACATGG - Intronic
1033982813 7:147187118-147187140 CTGGGGAGAAAGAATGAACATGG + Intronic
1034748618 7:153547083-153547105 CTGGTGAGACAGAAGGAAGGAGG - Intergenic
1035659302 8:1334714-1334736 GTGGTGCTACAGAAGGCACACGG - Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036723261 8:11198257-11198279 CTTGAAATACTGCAGGAACATGG - Intronic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037739210 8:21591932-21591954 CTGGAGATAGAGGAAGAACAGGG + Intergenic
1038406014 8:27323483-27323505 CTTGAGATACAGAAGTAGAAGGG + Intronic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1040100742 8:43500907-43500929 TTGGAGATAGAGAAGCCACATGG + Intergenic
1040601100 8:48884561-48884583 ATGAAGATACATAAGAAACAGGG + Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1044086204 8:87945125-87945147 CTGGAAACACAGAAGAAACTTGG + Intergenic
1044989598 8:97783786-97783808 CTGAAGTTACAGAAAGAATAGGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045703808 8:104897149-104897171 CTGCAGATGCACAAGAAACAAGG + Intronic
1045948173 8:107820862-107820884 CTGGTGATAAATAAGAAACATGG - Intergenic
1046675725 8:117105871-117105893 CTGGAAATGCAGAAGAAATAGGG - Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047948934 8:129911799-129911821 CAGGAGATCCAGAAGTAAGAAGG - Intronic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048810945 8:138285479-138285501 CTGTCGCTACAGAAGGAACCTGG - Intronic
1049027833 8:140008612-140008634 CTGGACAAACAGCAGGCACAGGG + Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1050180849 9:2921064-2921086 CTGGAGCTACTGAAGAAGCAAGG - Intergenic
1050847491 9:10240387-10240409 CTAGAGAAACAGAAGGTCCAGGG + Intronic
1051923106 9:22290967-22290989 ATGAAGATAGAGAAGGAAGAAGG + Intergenic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1055101818 9:72473394-72473416 ATGGAAATACGGAAGGAAGAAGG + Intergenic
1055868948 9:80850956-80850978 CTGGAGAGACAGAGGTTACATGG + Intergenic
1058133021 9:101274849-101274871 CTGAACCCACAGAAGGAACATGG - Intronic
1058318947 9:103606005-103606027 CTGGAGAAACTGAAGGAATGGGG - Intergenic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1060880914 9:127117455-127117477 CTGGAGGTAGAACAGGAACAAGG + Intronic
1062490691 9:136803531-136803553 CTGGGGATACAGCAGGGACCGGG + Intronic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1185634717 X:1543311-1543333 CTGGACATTCAGACGGAAGAGGG + Intergenic
1185689146 X:2138937-2138959 GTGAAGATACAGTAGGAAGAAGG + Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186306415 X:8264562-8264584 CCAGAGAAACAGAATGAACAGGG - Intergenic
1186973027 X:14870408-14870430 CAGAAGATACAGAAGTAACTAGG + Intronic
1188087098 X:25913021-25913043 GTGGAGATGAAGGAGGAACATGG - Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188745824 X:33841944-33841966 GTGGAGATACAGATAGCACAGGG - Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1192233123 X:69279335-69279357 CAGAAGAGACAGAGGGAACAGGG - Intergenic
1195363573 X:104107127-104107149 GTGGGGATATAGATGGAACAGGG - Intronic
1195480277 X:105337120-105337142 TTGAAGATACAGCAGAAACATGG - Intronic
1195536733 X:106015898-106015920 CTGCAAATACAGAAGCAATAGGG + Intergenic
1195540617 X:106058683-106058705 ATGGTGAGACAGAAGGCACAGGG + Intergenic
1196434777 X:115664955-115664977 CTCGTGTTACTGAAGGAACAAGG + Intergenic
1198792081 X:140356652-140356674 GTGGAGGTAGAGAAGGGACAGGG + Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1198845288 X:140903831-140903853 CTGGAGAGACAGCAACAACAAGG - Intergenic
1199623363 X:149718331-149718353 CTGGAGATGAGGAAAGAACATGG + Intergenic
1202193622 Y:22272526-22272548 CTGAAGATCCAGAGGGCACATGG + Intergenic