ID: 1037426466

View in Genome Browser
Species Human (GRCh38)
Location 8:18760959-18760981
Sequence AGATTATCCTGGAATATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037426466_1037426470 19 Left 1037426466 8:18760959-18760981 CCATCAATATTCCAGGATAATCT No data
Right 1037426470 8:18761001-18761023 GAACTAGTTTGCTTCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037426466 Original CRISPR AGATTATCCTGGAATATTGA TGG (reversed) Intronic