ID: 1037426472

View in Genome Browser
Species Human (GRCh38)
Location 8:18761018-18761040
Sequence CAAAGGTTCTTCAAGATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037426469_1037426472 25 Left 1037426469 8:18760970-18760992 CCAGGATAATCTTGGGATCTTAG 0: 1
1: 0
2: 1
3: 14
4: 237
Right 1037426472 8:18761018-18761040 CAAAGGTTCTTCAAGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037426472 Original CRISPR CAAAGGTTCTTCAAGATTCC AGG Intronic
No off target data available for this crispr