ID: 1037432397

View in Genome Browser
Species Human (GRCh38)
Location 8:18827516-18827538
Sequence TAACTAGGTGGTATTATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037432393_1037432397 -7 Left 1037432393 8:18827500-18827522 CCAGATTCAAGAGCGGTAACTAG 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1037432397 8:18827516-18827538 TAACTAGGTGGTATTATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037432397 Original CRISPR TAACTAGGTGGTATTATGGA AGG Intronic
No off target data available for this crispr