ID: 1037433193

View in Genome Browser
Species Human (GRCh38)
Location 8:18835823-18835845
Sequence GAGTGAGCAACAAGAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037433186_1037433193 23 Left 1037433186 8:18835777-18835799 CCCGGCGTGCTCAGAAATGGCCA 0: 1
1: 0
2: 1
3: 11
4: 81
Right 1037433193 8:18835823-18835845 GAGTGAGCAACAAGAGTGGGAGG No data
1037433189_1037433193 3 Left 1037433189 8:18835797-18835819 CCAAAGAGGCCAATGCAACTGAA 0: 1
1: 0
2: 1
3: 14
4: 172
Right 1037433193 8:18835823-18835845 GAGTGAGCAACAAGAGTGGGAGG No data
1037433187_1037433193 22 Left 1037433187 8:18835778-18835800 CCGGCGTGCTCAGAAATGGCCAA 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1037433193 8:18835823-18835845 GAGTGAGCAACAAGAGTGGGAGG No data
1037433190_1037433193 -6 Left 1037433190 8:18835806-18835828 CCAATGCAACTGAAGCAGAGTGA 0: 1
1: 0
2: 2
3: 38
4: 269
Right 1037433193 8:18835823-18835845 GAGTGAGCAACAAGAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037433193 Original CRISPR GAGTGAGCAACAAGAGTGGG AGG Intronic
No off target data available for this crispr