ID: 1037442654

View in Genome Browser
Species Human (GRCh38)
Location 8:18932296-18932318
Sequence TTTGCATTCAGTAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037442647_1037442654 24 Left 1037442647 8:18932249-18932271 CCTGTCGTAGGCTGGGACCCAGG 0: 1
1: 0
2: 1
3: 8
4: 105
Right 1037442654 8:18932296-18932318 TTTGCATTCAGTAAAGTGGGAGG No data
1037442649_1037442654 7 Left 1037442649 8:18932266-18932288 CCCAGGCTCTGCTGCAGCTGCCA 0: 1
1: 0
2: 9
3: 96
4: 585
Right 1037442654 8:18932296-18932318 TTTGCATTCAGTAAAGTGGGAGG No data
1037442650_1037442654 6 Left 1037442650 8:18932267-18932289 CCAGGCTCTGCTGCAGCTGCCAT 0: 1
1: 0
2: 3
3: 77
4: 530
Right 1037442654 8:18932296-18932318 TTTGCATTCAGTAAAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037442654 Original CRISPR TTTGCATTCAGTAAAGTGGG AGG Intronic
No off target data available for this crispr