ID: 1037450647

View in Genome Browser
Species Human (GRCh38)
Location 8:19013533-19013555
Sequence CCGCGCCCGCGCCCCGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1354
Summary {0: 1, 1: 1, 2: 27, 3: 222, 4: 1103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037450641_1037450647 8 Left 1037450641 8:19013502-19013524 CCACGTCGAACAGCGGCGCCGCG 0: 1
1: 0
2: 1
3: 2
4: 21
Right 1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG 0: 1
1: 1
2: 27
3: 222
4: 1103
1037450642_1037450647 -10 Left 1037450642 8:19013520-19013542 CCGCGTGCGCACCCCGCGCCCGC 0: 1
1: 0
2: 3
3: 45
4: 290
Right 1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG 0: 1
1: 1
2: 27
3: 222
4: 1103
1037450640_1037450647 9 Left 1037450640 8:19013501-19013523 CCCACGTCGAACAGCGGCGCCGC 0: 1
1: 0
2: 0
3: 1
4: 9
Right 1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG 0: 1
1: 1
2: 27
3: 222
4: 1103
1037450639_1037450647 10 Left 1037450639 8:19013500-19013522 CCCCACGTCGAACAGCGGCGCCG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG 0: 1
1: 1
2: 27
3: 222
4: 1103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037450647 Original CRISPR CCGCGCCCGCGCCCCGGCCC CGG Intronic
900088674 1:909972-909994 CCGCGCCGCCGCCCCTGCCCAGG - Intergenic
900117037 1:1033326-1033348 CTGCGCCCGCGGCCCCGCCCTGG - Intronic
900189934 1:1349101-1349123 CCGCGTCCGAGCCCCGGGCCGGG - Exonic
900191771 1:1355147-1355169 CCGCGCCCCCTCCGCAGCCCCGG - Exonic
900342230 1:2194659-2194681 CCGCGCCCCCGCCCGGCTCCCGG + Intronic
900378807 1:2373614-2373636 CCGAGCCTGGGTCCCGGCCCAGG - Intronic
900626675 1:3611640-3611662 CCCCACCAGCGCCCCGCCCCCGG + Intergenic
900629327 1:3625286-3625308 CTCGGCCCCCGCCCCGGCCCTGG - Intronic
901019757 1:6249699-6249721 CCGCGCCGCCGCCCCGGGCCCGG - Exonic
901055535 1:6447271-6447293 GAGCGTCCGGGCCCCGGCCCTGG - Intronic
901109770 1:6785436-6785458 CCGCCGCCGCGCACCCGCCCTGG - Exonic
901332809 1:8423868-8423890 GGGGCCCCGCGCCCCGGCCCCGG + Intronic
901433998 1:9235085-9235107 CCCCGCCGCCGCCCCGGCCCCGG + Intronic
901660838 1:10796760-10796782 CCGGCCCCGCGATCCGGCCCGGG - Intergenic
902230087 1:15022263-15022285 CCACGCCCGCACCCCGCCCCAGG + Intronic
902250704 1:15153033-15153055 GCACGCCCGAGTCCCGGCCCAGG - Intronic
902304119 1:15524295-15524317 CTGCCCCCGCGTCACGGCCCCGG + Exonic
902406285 1:16185274-16185296 CAGCTCCCGCACCCCTGCCCTGG - Intergenic
902451501 1:16499352-16499374 CCCCGCCCCCGCCTCGGCCCCGG - Intergenic
902451506 1:16499358-16499380 CCCCGCCCCCGCCCCCGCCTCGG - Intergenic
902842861 1:19086329-19086351 CCACCCCCGCCCCCCCGCCCAGG - Intronic
902940973 1:19799944-19799966 CCGCGTCCCGGCCCCGGTCCCGG + Intronic
903153306 1:21428273-21428295 CCGCGCCCGGGCCCCGGCGATGG + Intergenic
903468368 1:23568131-23568153 CCCCGCCCGCGCCCCGCGCCCGG + Intergenic
903501015 1:23800278-23800300 CCCCGCCCCCGCCCCGCGCCTGG + Intronic
903514747 1:23902874-23902896 CCCCGCCAGCGCCGCGGCCGCGG - Intronic
903514775 1:23902967-23902989 CCGCGCCCTCGCGCCGCGCCGGG + Intronic
903555069 1:24187262-24187284 CGGCGTCCCCGCCCGGGCCCAGG + Intronic
904039475 1:27575744-27575766 CCCTTCCCGCGCCCCGGGCCCGG + Intronic
904171053 1:28592445-28592467 CCCCGACCCCGCCCCTGCCCGGG - Intronic
904215435 1:28914891-28914913 GAGAGCCCGCGCCCCGGCCCGGG - Intronic
904267273 1:29325218-29325240 CTGCGCCTGCGCCACGGTCCTGG + Exonic
904500112 1:30908509-30908531 CCGGGGCCGCGGCCGGGCCCGGG - Exonic
904528813 1:31155037-31155059 CCGCCCTCGTCCCCCGGCCCGGG - Intergenic
904768968 1:32870621-32870643 CGGCGCCGGCCCCCCGCCCCGGG + Intronic
904837726 1:33349814-33349836 CGCCGCCCGCGCTCCCGCCCCGG - Intronic
904837759 1:33349934-33349956 CCGCTCCCTCGCCCCGCCCCCGG - Intronic
905037951 1:34929706-34929728 CCCCGCCCCCGCCCCCGCGCAGG + Intergenic
905066865 1:35192145-35192167 CCTCGCCCCCGCCCCCGCGCTGG - Intronic
905442696 1:38005295-38005317 CCGCCCCCGCGCCCAGGCCGGGG - Intronic
905442780 1:38005561-38005583 CCCCGCCCGGACCCCGCCCCCGG + Intronic
905569305 1:38991346-38991368 CCGCGTCCGCTCCCGGTCCCTGG + Exonic
905789818 1:40784031-40784053 CCCCGAGCGCGCCCCCGCCCCGG + Exonic
906062536 1:42958186-42958208 CCCCGGCCCGGCCCCGGCCCCGG - Intronic
906062539 1:42958192-42958214 CCGAGCCCCCGGCCCGGCCCCGG - Intronic
906117763 1:43367383-43367405 TGGCGCCCTCGCCCCGGCCTGGG - Intronic
906317843 1:44799862-44799884 CCTCGCCCTCGCCCGGGGCCCGG - Intergenic
906318012 1:44800516-44800538 CCGCGCCCGCTCCCCCGGCCGGG + Exonic
906318016 1:44800522-44800544 CCGCTCCCCCGGCCGGGCCCGGG + Exonic
906637004 1:47416473-47416495 CCACGCCCGCGCCCGGCCCGGGG + Exonic
907261331 1:53220675-53220697 CCTGCCCCGCGGCCCGGCCCCGG - Intergenic
907444741 1:54500227-54500249 CCGCCCCCGCTCCCCGAGCCAGG - Intergenic
908703855 1:66930135-66930157 CCGCGCGCGCGCCCCTGCTCCGG + Intronic
911176156 1:94820348-94820370 CCCAGCCCCAGCCCCGGCCCCGG + Exonic
911176160 1:94820354-94820376 CCCAGCCCCGGCCCCGGCCCCGG + Exonic
912246384 1:107965276-107965298 CCTCCCCCGCGCCCCGCCCTCGG - Intergenic
912381324 1:109249664-109249686 CCCCGACCCCGGCCCGGCCCCGG - Intergenic
912411564 1:109483926-109483948 CCGCGGACGCGCGCCCGCCCTGG - Exonic
912800187 1:112715326-112715348 CCGCGGCCCCGCCCCCGCCCAGG + Exonic
912804276 1:112743456-112743478 CCGCACACTCGCCCCGCCCCAGG + Intergenic
912915739 1:113812517-113812539 CCGCGCCCCCGCCGCGTCCCCGG + Intergenic
913209360 1:116570496-116570518 CCGCGCCCGCTCCCCGTCCCGGG + Intronic
913274172 1:117121709-117121731 CCTCTCCCGCGCCTCGGCCCGGG + Exonic
914702944 1:150150380-150150402 GCCCGGCCGCGCCCCCGCCCCGG + Intronic
914758466 1:150579777-150579799 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
915165697 1:153946642-153946664 CGGCGCCCGCGGCCCGGAGCGGG - Exonic
915747773 1:158177932-158177954 CTGGCCCCGCGCCCCGCCCCAGG + Intergenic
915937828 1:160099094-160099116 CCCCGGCCTCGCCCCGCCCCTGG + Intergenic
916773446 1:167936197-167936219 CCCCGCCCGCGCCTCGGGGCGGG - Intronic
916792513 1:168136709-168136731 CCGCGCCCGCGCCCCACGCCGGG + Intronic
917944460 1:179954857-179954879 CTGGCCCCGCTCCCCGGCCCGGG - Exonic
917962263 1:180154714-180154736 CCCCGCCCGCTCCCGCGCCCAGG + Intergenic
918015982 1:180632523-180632545 CCCGGCCCCGGCCCCGGCCCGGG - Intronic
918015986 1:180632529-180632551 CCGTTCCCCGGCCCCGGCCCCGG - Intronic
918283009 1:183023736-183023758 CCGCGCCGGCCCTGCGGCCCCGG + Exonic
918487494 1:185045320-185045342 CCGCGCCACCGCCCCGCCCTGGG - Intergenic
919895703 1:202008452-202008474 CCGCCCCCCCGCCCCCGCACTGG - Exonic
920095373 1:203483266-203483288 CTGCGCCCGGGCCCAGTCCCGGG - Exonic
921029707 1:211326773-211326795 CCGCGCCCCGGCCCCGCCCCAGG + Intronic
921089558 1:211830408-211830430 CCGCGCCCCCGCCTCCTCCCCGG + Intronic
921190039 1:212700314-212700336 CTGCGTCCGCCCCCCGGCGCGGG + Intergenic
922124911 1:222712522-222712544 CCGCCCCCGAGGCCCCGCCCCGG + Exonic
922307531 1:224357128-224357150 CGGGGCCCGCGCCACCGCCCCGG - Intronic
922581782 1:226703557-226703579 CGGCGCCCCCTCCCCGGCCGCGG - Intronic
922718039 1:227887154-227887176 CCCCGCCCCCTGCCCGGCCCAGG - Intergenic
922739362 1:228006867-228006889 CCCCGCCCGGGCCCCGGCCCCGG + Intergenic
922739433 1:228007044-228007066 CCGCGCCAGCTCCCAGGGCCCGG + Exonic
923007927 1:230067099-230067121 CGGCGCCCGAGCTCCGCCCCGGG - Intronic
923161360 1:231317492-231317514 CGGCGCCCGCGGGCCGGCACGGG + Intergenic
923171487 1:231421610-231421632 GGGCTCCCGGGCCCCGGCCCTGG + Exonic
923400779 1:233614078-233614100 CGCCGCCCCCGCCCCCGCCCGGG - Exonic
923506416 1:234609668-234609690 CGGCGCCCGCGCAGCGCCCCCGG + Intergenic
923631153 1:235650099-235650121 CCCCGCCCCCGCCCCAGCCCGGG + Intronic
923684142 1:236142402-236142424 CGGCCCGCGCGCCCCCGCCCCGG - Intergenic
924482603 1:244451182-244451204 CCGCCCCCCCGCCCCGCCCAGGG - Intronic
1062843720 10:689467-689489 CCGGGCCCCCGCCCCGGGCCGGG - Intronic
1062873880 10:930957-930979 CCGCGACCCCGGCCCCGCCCAGG + Intronic
1062874010 10:931280-931302 CCCTGCCCCGGCCCCGGCCCCGG + Intronic
1062874014 10:931286-931308 CCCGGCCCCGGCCCCGGCCCAGG + Intronic
1063429561 10:5977247-5977269 CCGCGTCCCCTCCCCGGCCTGGG + Intronic
1063663532 10:8049213-8049235 ACGCCCACGCGCCCCGGGCCAGG - Intergenic
1064086523 10:12349743-12349765 CTGCGCCCGCGCCGCGCCCCCGG + Exonic
1064245679 10:13666047-13666069 CCACTCCCACGCCCGGGCCCCGG - Intronic
1064418088 10:15168201-15168223 CCCCGCCGGCGGCCTGGCCCAGG - Intronic
1064443189 10:15371321-15371343 CGCTGCCCGCGCCCAGGCCCCGG + Intergenic
1064622443 10:17229379-17229401 CCGCGCCACCGCCGCCGCCCAGG + Exonic
1065025392 10:21535115-21535137 CCCCGCCCCCGCCCCCACCCCGG - Intronic
1065100460 10:22325836-22325858 CCGCGCTCAGGCCCCGGCCCAGG + Intronic
1065189225 10:23195132-23195154 CAGTGCCGGCGCCCCGGCTCTGG - Intergenic
1065458790 10:25934466-25934488 CCGCGACCGCCCGCCCGCCCAGG + Intronic
1065844640 10:29735249-29735271 TGGCTCCCGCGCCCCAGCCCGGG - Intronic
1066220547 10:33334231-33334253 CCCCGCCTGAGCCCCGGTCCGGG + Intronic
1067071860 10:43138387-43138409 GCGCGCCCGCGGCCCCGCCCAGG - Intergenic
1067389157 10:45847506-45847528 CCTGGCCCTGGCCCCGGCCCCGG + Intronic
1067445102 10:46337043-46337065 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1067445105 10:46337049-46337071 CCTGGCCCCGGCCCCGGCCCCGG - Intergenic
1067502317 10:46816335-46816357 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1067502320 10:46816341-46816363 CCTGGCCCCGGCCCCGGCCCCGG - Intergenic
1067592267 10:47523679-47523701 CCTGGCCCCGGCCCCGGCCCCGG + Intronic
1067592270 10:47523685-47523707 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1067639386 10:48031758-48031780 CCCGGCCCCGGCCCCGGCCCCGG + Intergenic
1069024144 10:63521663-63521685 CCCCGTCCCCGCCCAGGCCCAGG - Intronic
1069438395 10:68406870-68406892 CCCCGCCTGCTCCCCGACCCGGG + Exonic
1069470730 10:68687134-68687156 CCGCCCCCCCGCCCCCGCCTTGG + Intronic
1069761679 10:70815865-70815887 CCGCGCGCACGCCCAGACCCGGG - Intergenic
1069761812 10:70816247-70816269 GCCCGCCCCCGCCCCCGCCCCGG - Intronic
1069769347 10:70887919-70887941 CCCCGCCCCCGCCCCCGCCCCGG + Intronic
1070136376 10:73697908-73697930 CCTGGCCCCGGCCCCGGCCCCGG + Exonic
1070752780 10:78973863-78973885 CCGCGCCCCGGCCCCAGCCCCGG - Intergenic
1071527387 10:86366419-86366441 CCTCGGCCTCGCCCCGGGCCCGG - Exonic
1073088536 10:100912714-100912736 CCGCCCCCGCGCGCCGGCCAAGG + Intronic
1073097302 10:100987618-100987640 CCGCGCCGGCCCCCAGCCCCAGG - Intronic
1073099624 10:100999846-100999868 CCCGGCCCCGGCCCCGGCCCTGG - Exonic
1073137735 10:101229054-101229076 GCGCGCCCCGGCTCCGGCCCCGG - Exonic
1073138035 10:101230307-101230329 CTCCGCCCGGGCCCCGGCCGGGG + Intergenic
1073207481 10:101776425-101776447 CCTCGCGCGCTCCCCGGTCCCGG + Intronic
1073265632 10:102226687-102226709 ACCCCCTCGCGCCCCGGCCCCGG - Intronic
1073287632 10:102398302-102398324 CCGGGCCCGGGCCCTAGCCCTGG - Intronic
1074086157 10:110210087-110210109 CCACGCCGGAGCCCCGGCACGGG - Intronic
1074182601 10:111077389-111077411 CAGAGTCCGCGCCCCAGCCCCGG + Exonic
1074182605 10:111077395-111077417 CCGCGCCCCAGCCCCGGGCCGGG + Exonic
1074829857 10:117240941-117240963 CCGCGGCCGCGCCTCTTCCCCGG - Intergenic
1075144475 10:119872195-119872217 CAGGGCCAGGGCCCCGGCCCCGG - Intronic
1075748430 10:124743981-124744003 CCGCCGCCGCCGCCCGGCCCCGG + Intronic
1076035579 10:127196424-127196446 CCGCCCCCGCCTCCTGGCCCTGG - Intronic
1076372301 10:129963593-129963615 GCGCGCCCTGGCCCCGGCCCCGG - Intronic
1076707143 10:132308117-132308139 CCCCGCCCCTGCCCCGCCCCCGG - Intronic
1076749990 10:132537745-132537767 CCCCGCCCAGGCCCCGCCCCGGG + Intergenic
1076792761 10:132785738-132785760 CCGCGCCCACGGGCCGGCCCAGG + Exonic
1076792832 10:132785996-132786018 CCGCCCCTGCCCGCCGGCCCGGG + Exonic
1076792902 10:132786186-132786208 CAGCGCGCGCGCCGCGCCCCGGG - Intergenic
1076809517 10:132879364-132879386 CCCAGCCCGCGGCCCGTCCCGGG + Intronic
1076857588 10:133124831-133124853 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1076991992 11:280239-280261 CGCCGCGCGCGCCCCGGCTCAGG - Exonic
1077010086 11:375785-375807 CCCCGCCCTCGCCCCCGCGCGGG - Intronic
1077043730 11:535449-535471 CCCCGCCCCGGCCTCGGCCCCGG - Exonic
1077044300 11:537674-537696 CCGCGCCCACGCCTCGGCGCAGG - Intronic
1077121502 11:910943-910965 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1077121507 11:910949-910971 CCCCGCCCCGGCCCCGGCCCCGG - Intronic
1077121509 11:910955-910977 GCGCGGCCCCGCCCCGGCCCCGG - Intronic
1077201485 11:1309626-1309648 CAGCCGCCGCGCCCCGCCCCCGG + Intronic
1077360418 11:2138183-2138205 CGCCGCCCCAGCCCCGGCCCCGG + Intronic
1077360811 11:2139491-2139513 CGGAGCCCTCGCCCCGCCCCCGG + Intronic
1077495478 11:2884841-2884863 CCCCGCCCCGGCCCCGGCCCCGG - Exonic
1077495482 11:2884847-2884869 CCCGGCCCCCGCCCCGGCCCCGG - Exonic
1077495493 11:2884865-2884887 CCCGGCCCCGGCCCCGGCCCCGG - Exonic
1077495497 11:2884871-2884893 CCCAGCCCCGGCCCCGGCCCCGG - Exonic
1077495501 11:2884877-2884899 CCCGGCCCCAGCCCCGGCCCCGG - Exonic
1077495527 11:2884937-2884959 CCTGGCCCCGGCCCCGGCCCCGG - Exonic
1077914710 11:6603755-6603777 CCGCGCCCGCAGCCCGCCGCCGG - Intronic
1078225151 11:9384912-9384934 CCGCGCCTCCGGCCAGGCCCCGG - Intronic
1078246221 11:9574540-9574562 CCCCTCCGGCGCCGCGGCCCCGG - Intronic
1078390275 11:10931104-10931126 CCGCGCTCCAGCCCCCGCCCCGG + Intergenic
1078498329 11:11842283-11842305 CCGCAGCCGAACCCCGGCCCGGG - Intronic
1078699724 11:13668927-13668949 TCCCGCCCCCGCCCCCGCCCGGG + Intronic
1078771768 11:14358633-14358655 CCGCCCCCTGGCCCCGGCCCGGG + Intronic
1079122512 11:17695902-17695924 CCCGGCCCCGGCCCCGGCCCTGG - Intergenic
1079122516 11:17695908-17695930 CCCCGGCCCGGCCCCGGCCCCGG - Intergenic
1079122518 11:17695914-17695936 CCGCAGCCCCGGCCCGGCCCCGG - Intergenic
1079296833 11:19241683-19241705 ACGCCCGCTCGCCCCGGCCCCGG + Intergenic
1080230308 11:30012583-30012605 CCTCTCCCGCTCCCGGGCCCGGG + Exonic
1080230312 11:30012589-30012611 CCGCTCCCGGGCCCGGGCCTGGG + Exonic
1080418650 11:32091646-32091668 CCGCCGCCGCGCCCCGGCCGGGG + Intronic
1080551285 11:33375993-33376015 CCGCTCCCGCGCGCCCGGCCGGG - Intergenic
1081636774 11:44727044-44727066 CCGAGCCCCAGCCCCGGCCCCGG + Intronic
1081636784 11:44727062-44727084 CCCGGCCCCAGCCCCGGCCCCGG + Intronic
1081636788 11:44727068-44727090 CCCAGCCCCGGCCCCGGCCCCGG + Intronic
1081636792 11:44727074-44727096 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1081636796 11:44727080-44727102 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1081636800 11:44727086-44727108 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1081804985 11:45885616-45885638 CCGCGCGCGCCCCCGGGACCCGG - Intergenic
1081831471 11:46119883-46119905 CCCCGCCCGCGCCCCCGCCGGGG - Intronic
1081863670 11:46347999-46348021 TCCCGCCCGTGTCCCGGCCCTGG - Intronic
1082028854 11:47590740-47590762 CTGGGCCCGACCCCCGGCCCGGG - Exonic
1083329658 11:61891609-61891631 CCCCGCCCCCGGCCAGGCCCCGG + Intronic
1083572590 11:63768441-63768463 CCACGCCGGGGCCCCCGCCCGGG + Intronic
1083609773 11:63999302-63999324 CCCCACCCTCGCCCGGGCCCAGG + Intronic
1083611923 11:64008408-64008430 CCGCGCCCGCACCCTAACCCTGG - Intronic
1083624769 11:64066911-64066933 CGGAGCCCACGCCCCAGCCCAGG + Intronic
1083657050 11:64234732-64234754 CCGCGCCCGGGCCCGCGCCATGG + Exonic
1083886505 11:65575979-65576001 CCGCCCCCGCGCTCCTGCCCCGG + Intergenic
1084065980 11:66704738-66704760 CCGCGCTCGCTCGCCTGCCCGGG + Exonic
1084086148 11:66856348-66856370 CCCCGCCCGCCCCGCGGGCCAGG - Intronic
1084146151 11:67266426-67266448 CCGCCCGCGCGCCCGCGCCCCGG - Exonic
1084146266 11:67266845-67266867 CCCCGCGGGCGCCCCGGCCGCGG + Intronic
1084165301 11:67372613-67372635 CCCCGCCCCCGCCCCCGCCGCGG - Intronic
1084172960 11:67409480-67409502 CCGCGCCGGGACCCCCGCCCCGG + Exonic
1084275846 11:68050533-68050555 CCACGCCCACCTCCCGGCCCAGG - Exonic
1084284070 11:68120696-68120718 CCCGGCCTCCGCCCCGGCCCCGG + Intronic
1084973030 11:72781691-72781713 CGGCGCTGGCACCCCGGCCCCGG - Intronic
1085208111 11:74749198-74749220 CCGCGCCCGCGGCCCAGGCTGGG + Exonic
1085208143 11:74749306-74749328 CCGCGCCCCCGTCCCGGCGCGGG - Exonic
1085284654 11:75351788-75351810 CAGCGCCCGGGCCGCGGCCAGGG + Intergenic
1085519526 11:77129967-77129989 GCGGGCCCGGGCCCGGGCCCAGG + Intronic
1085519529 11:77129973-77129995 CCGGGCCCGGGCCCAGGCCCAGG + Intronic
1085561049 11:77473485-77473507 CCACCCCCGCGCCCCAGCCCTGG + Intronic
1086590527 11:88509335-88509357 CAGCGCCAGCGCCCAGGCCACGG + Exonic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1087175312 11:95090243-95090265 CGGCGCCCGCAGCCCGGCTCGGG - Intronic
1087634406 11:100687046-100687068 CCGCGCTTGCGCTCCGGCCTTGG - Intergenic
1088462091 11:110093029-110093051 GCGCGCCCGAGCCGGGGCCCTGG + Intergenic
1088495801 11:110430240-110430262 CCGCGCTCCCGCCCGGCCCCCGG - Exonic
1088613613 11:111602362-111602384 CCGCCCCCGCCCCCCTGCCCCGG + Intergenic
1089442908 11:118531245-118531267 CCGCCCCCGCCCCCCGCCACCGG - Intronic
1089499822 11:118925510-118925532 CCGGCCCCGCGCCCCGGCCCCGG - Intronic
1089533851 11:119149212-119149234 CCCCGGCCCCGCCCCGGCCCGGG + Exonic
1090285602 11:125496308-125496330 CCGCGCTCGTGCCCGGGCTCCGG + Exonic
1090780296 11:130001955-130001977 CCGGCCCCCCGCCCCGGTCCCGG + Intronic
1091259525 11:134223771-134223793 CCCCACCGGCACCCCGGCCCGGG + Intronic
1091273103 11:134331849-134331871 CAGAGGCCCCGCCCCGGCCCCGG + Intergenic
1091286588 11:134411855-134411877 CGGCCCCTACGCCCCGGCCCCGG + Intronic
1091434018 12:459903-459925 CCCCGCCCCCGCCCCCGCCCCGG - Intergenic
1091550200 12:1530726-1530748 CCAGCCCCGCGCCCCGGCCGCGG + Intronic
1091888079 12:4031265-4031287 CCGCGCCCCCGCCCGGGGCCGGG + Intergenic
1092216781 12:6689128-6689150 CCCCTCCCGCGCCCTGGCTCAGG - Intronic
1092242020 12:6841064-6841086 CCCTGCCTGCGCCCCAGCCCAGG - Intronic
1092861835 12:12725265-12725287 CCGCGCTCCGGCCGCGGCCCCGG + Intergenic
1093175676 12:15911253-15911275 CCGGGCCCGCGACTCCGCCCCGG + Exonic
1093464846 12:19439376-19439398 GCCCGCCCCCGCCCCCGCCCCGG - Intronic
1094108024 12:26833446-26833468 ACGCGCCCGCTCCCCCGCCGGGG - Intergenic
1094147327 12:27244228-27244250 CTCCGCCCTCGCCCCGCCCCCGG - Exonic
1095349185 12:41188875-41188897 CCCCGCGCGCGCCCCCGCCCCGG - Exonic
1095687232 12:45050474-45050496 CCGCGCCCGCGCCCCCAGGCCGG - Intronic
1096139927 12:49234520-49234542 CCGAGCCCAGGCCCAGGCCCTGG - Intronic
1096214236 12:49790916-49790938 CCGTGCCCAAGCCCTGGCCCAGG + Intergenic
1096466164 12:51848603-51848625 CCCGGCCCGCGCCGCCGCCCCGG - Intergenic
1096482503 12:51951841-51951863 CGGCCCCCGCCCCCCGTCCCAGG - Intronic
1096651357 12:53063482-53063504 CCCAGCCCCAGCCCCGGCCCCGG + Intronic
1096784419 12:54009067-54009089 CGCCGCCCGCGCCCCAGCCCCGG + Intronic
1096796738 12:54082567-54082589 CCGGCCCCGGCCCCCGGCCCCGG - Intergenic
1096796747 12:54082580-54082602 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1096796751 12:54082586-54082608 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1096796755 12:54082592-54082614 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1096800407 12:54106845-54106867 CCGCGCCCTCGCCCGGGACTCGG + Intergenic
1097155022 12:57006268-57006290 CCCCGCCCGCGCGCCGACCCCGG - Intronic
1097246780 12:57611490-57611512 CCTCGCCTCCTCCCCGGCCCGGG + Intronic
1098288517 12:68933218-68933240 GCGCGCCCGGGCCCCGCCCCCGG + Intronic
1100469054 12:94873827-94873849 CCGCGCCTCCGCCGCAGCCCGGG - Intergenic
1101371811 12:104137822-104137844 CCGCGGCCCCTCCTCGGCCCCGG + Intronic
1101371968 12:104138350-104138372 CCCCGGCCCCGCCCCGCCCCCGG + Intergenic
1101640381 12:106582608-106582630 CCCCGCCCGCGCCCCCCTCCCGG + Intronic
1102371121 12:112382675-112382697 TCGGGCCCGCGCCCCCACCCTGG + Intergenic
1102457172 12:113077964-113077986 CCGAGCCCGCGCCGCCTCCCGGG + Exonic
1102520084 12:113472486-113472508 CCGAGCCCAGGCCCAGGCCCAGG + Intergenic
1102646161 12:114405345-114405367 CCGCGCCCTCGCCAGGGTCCCGG + Intronic
1102937578 12:116910887-116910909 CCACGCCCCCGCCACGCCCCCGG - Intergenic
1103074204 12:117969091-117969113 CCCCAGCCGGGCCCCGGCCCCGG + Intergenic
1103092003 12:118104070-118104092 CAGCCTCCGCGCCCCGCCCCTGG - Intronic
1103364069 12:120369462-120369484 CCGCGGCCGGGCCCCCGCGCCGG - Intergenic
1103595600 12:122022712-122022734 CCGCTCCCGCCTCCCGGGCCCGG + Intronic
1103749765 12:123150830-123150852 GAGCGCCCGCCCCGCGGCCCCGG + Intergenic
1103828708 12:123762140-123762162 CGCAGCCCACGCCCCGGCCCCGG - Intergenic
1103856325 12:123973102-123973124 CCGCCCCCGCCCCCCAGCCCCGG - Exonic
1104021175 12:124993582-124993604 CCGCGCCCCGCCCCCGGCGCGGG - Intergenic
1104376184 12:128267098-128267120 CCCCGCCCCCGCCCCCGCCCGGG - Intergenic
1104692302 12:130836140-130836162 CCCCTCCCCCGCCCCGCCCCAGG - Intronic
1104928034 12:132323804-132323826 CCGGGCCCCCGCCCCGGCCGAGG - Intronic
1104930528 12:132337146-132337168 TTGCGCCTGCGCCCCGGCCGTGG + Intergenic
1105000610 12:132687705-132687727 CCGCGGCAGCGCCCCGAGCCCGG - Exonic
1105031410 12:132887159-132887181 CCGGCCCCGGCCCCCGGCCCCGG + Intronic
1105418284 13:20231934-20231956 CTGTCCACGCGCCCCGGCCCCGG - Intronic
1105472146 13:20703918-20703940 CCGCGCCCGTGTCCCGCCCGCGG - Intronic
1105502881 13:20988336-20988358 CCCCGCCCCCGCCCCGGCTGCGG - Exonic
1105502886 13:20988342-20988364 CCCCGCCCCCGCCCCCGCCCCGG - Exonic
1105535181 13:21259334-21259356 CCCCCCCCGCACCCCGTCCCCGG - Intergenic
1105578631 13:21674461-21674483 CCGCGCCCCCGCCTCCGCTCCGG + Intronic
1105805625 13:23950312-23950334 CCGGGCCAGGGCCCAGGCCCAGG - Intergenic
1105964416 13:25371961-25371983 CCGCCCCCACGCCGCAGCCCGGG + Intergenic
1106517167 13:30465403-30465425 CCGCGCCGGCCCCGCCGCCCCGG + Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1107495461 13:40921862-40921884 CCCAGCCCGCAACCCGGCCCGGG + Intergenic
1108313875 13:49220076-49220098 CCGCTCCCGCGCCCTCTCCCGGG - Intergenic
1108350348 13:49585654-49585676 CACCGCCCCGGCCCCGGCCCCGG + Intergenic
1108541646 13:51452221-51452243 CGGGGCCCGGGCTCCGGCCCCGG - Intronic
1110318277 13:74134549-74134571 CTGCCCCCGCCCTCCGGCCCCGG + Intergenic
1110444229 13:75559328-75559350 CCGCGCCCGGCCCTCAGCCCCGG + Intronic
1112344298 13:98577167-98577189 CCGCGCCCGCCCCCACGGCCCGG + Intronic
1112344303 13:98577173-98577195 CCGCCCCCACGGCCCGGCCGGGG + Intronic
1112449843 13:99498638-99498660 CCGCGTACGAGCCCCGCCCCCGG + Intergenic
1112506785 13:99980632-99980654 CCGCGCCCCCGCCCCGCTGCCGG - Intergenic
1112506991 13:99981403-99981425 CCGCCCCGGCGCCCCCGCCGCGG + Intergenic
1113085633 13:106567443-106567465 CCGCGCCCGGTCCCCAGCCCCGG + Intronic
1113120246 13:106917589-106917611 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1113120250 13:106917595-106917617 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1113120254 13:106917601-106917623 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1113120258 13:106917607-106917629 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1113120262 13:106917613-106917635 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1113312037 13:109140999-109141021 CCCCGCCCCCGCCCCCGCCCGGG + Exonic
1113513724 13:110874805-110874827 CCGCGCCGGCGCCCCGCCCCCGG + Intergenic
1113541819 13:111115281-111115303 CCGCCGCCGCCCCCCGGCCTCGG - Exonic
1113656175 13:112068783-112068805 TCACGCCCGCGCCCGCGCCCTGG - Exonic
1113748903 13:112765149-112765171 CCTCCCCCCCGCCCCGGCTCTGG + Intronic
1113769231 13:112897978-112898000 CCCAGCCCCGGCCCCGGCCCCGG + Intronic
1113769235 13:112897984-112898006 CCCGGCCCCGGCCCCGGCCCTGG + Intronic
1113792145 13:113034637-113034659 CCACGCCCTCGCCCTTGCCCTGG + Intronic
1113792164 13:113034700-113034722 CCGCGCCCTTGCCCTTGCCCTGG + Intronic
1113874400 13:113585156-113585178 CCCAGCCCCGGCCCCGGCCCCGG - Intronic
1113874403 13:113585162-113585184 CCTGGCCCCAGCCCCGGCCCCGG - Intronic
1114452540 14:22836758-22836780 CCGCGGCCGGGCCCACGCCCTGG - Exonic
1114473778 14:22980864-22980886 CCGCGCCCCCACCCGGGCCCAGG - Intronic
1114525553 14:23365386-23365408 CTGCTCACCCGCCCCGGCCCGGG - Exonic
1115320708 14:32076993-32077015 CCGCGCCGCCGCTCCGCCCCCGG + Intronic
1116817853 14:49599765-49599787 CCGGATCCCCGCCCCGGCCCCGG - Intronic
1116817917 14:49599934-49599956 CGGAGCCCCCGCCCCGGCCCCGG - Intronic
1117141020 14:52791394-52791416 CTGCTCTCGCGCCCCGGCCCCGG + Intronic
1117392010 14:55271504-55271526 CCCCGGCCGCGGCCTGGCCCGGG - Exonic
1117478306 14:56118759-56118781 CCCCGCCCGCGCCGCTGCCCGGG - Intronic
1117478345 14:56118874-56118896 CCGCCCCCGCGCCGCCGTCCGGG - Intronic
1117978819 14:61322077-61322099 CGGCGCCGCTGCCCCGGCCCCGG - Exonic
1118019350 14:61695412-61695434 GCGCGCCCGCTCGCCTGCCCAGG - Intergenic
1118137491 14:63045555-63045577 CAGAGCCCGCGCCCAGGCGCCGG - Intronic
1118220889 14:63853513-63853535 CCCCTCCCGGGCCCAGGCCCCGG + Intronic
1118725876 14:68628671-68628693 CCACGCCCGCGACTCAGCCCAGG - Intronic
1118752347 14:68816424-68816446 CCTCGCCCGGGCCCCGCGCCCGG - Intergenic
1119286388 14:73458351-73458373 CTCCGCCCTGGCCCCGGCCCCGG + Intronic
1119286393 14:73458357-73458379 CCTGGCCCCGGCCCCGGCCCGGG + Intronic
1119418662 14:74493401-74493423 GCCCGCCCGCGCCCCGCCCCCGG + Exonic
1119418667 14:74493407-74493429 CCGCGCCCCGCCCCCGGCTCCGG + Exonic
1119435553 14:74595596-74595618 CCAGCCCCGCGCCCAGGCCCAGG + Intronic
1119539292 14:75428199-75428221 CTGCAGCCGGGCCCCGGCCCCGG + Intronic
1120788028 14:88554739-88554761 CCGCACCCGCACGCCAGCCCGGG + Intergenic
1121050367 14:90816078-90816100 CCCTGCCCGCGCCCCGCGCCCGG + Intronic
1121050528 14:90816544-90816566 CCCCGCCCCTGCCCCAGCCCTGG - Intergenic
1121074946 14:91060285-91060307 GCGCGCCCCCGCGCCGGGCCCGG + Intronic
1122137894 14:99645212-99645234 CAGCGCCCCGGCCCTGGCCCGGG - Exonic
1122221198 14:100239931-100239953 CCGGCCGCGCGCCCCGGCCCCGG + Intronic
1122532487 14:102438249-102438271 CCGCTCCTGCTCCCCGCCCCCGG + Intronic
1122624128 14:103075553-103075575 CTCCGCGCGGGCCCCGGCCCTGG + Intergenic
1122771384 14:104099449-104099471 CCAAGCCCGCCCCCTGGCCCTGG + Intronic
1122888993 14:104724082-104724104 CCGCCCCCTCGCCGCTGCCCGGG - Intergenic
1122917518 14:104865761-104865783 CCGGGTCCCCGCCCCGGCACCGG + Intronic
1122978492 14:105180926-105180948 CCGCGGCCCCTCCCCGGCCTGGG + Intronic
1122993250 14:105248797-105248819 CCGCGCCCTCGCGCCGCGCCGGG - Exonic
1123004588 14:105315105-105315127 GCGCGCCCCATCCCCGGCCCGGG + Exonic
1123021050 14:105398217-105398239 CCGCCCGCGCGCCCCGTCCTGGG + Intergenic
1123037987 14:105479073-105479095 CCCCGCCCCCGCCCCCGCCCCGG + Intronic
1123500814 15:20878826-20878848 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1123558065 15:21452521-21452543 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1123594293 15:21889802-21889824 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1124109456 15:26772964-26772986 CCTCCGCCGCGCCCCGGCACGGG + Exonic
1124340309 15:28886005-28886027 CCGGGCCTGCGCCCCCGCCCCGG - Exonic
1124427068 15:29571001-29571023 TCGCGCCCGCGCTCGGGCCGGGG - Intergenic
1125180992 15:36880716-36880738 TCTCTCCCGCGCCCCAGCCCCGG + Intergenic
1125834253 15:42736476-42736498 CCACGCTCGCGGGCCGGCCCCGG + Exonic
1125903643 15:43370977-43370999 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1125903647 15:43370983-43371005 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1126786204 15:52179643-52179665 CCAGGCCCGCGCCACCGCCCGGG - Intronic
1126852135 15:52804037-52804059 CAGCGGCCGCGTCACGGCCCGGG - Intergenic
1127142733 15:55993760-55993782 GCGCGCCCCCGCCCAGCCCCAGG - Intergenic
1127342908 15:58065896-58065918 GCGCTCCCGCCCCCCGGCCGCGG + Exonic
1127433292 15:58933204-58933226 CCCGCCCCGCGCCCCGGGCCGGG - Intronic
1127753419 15:62067984-62068006 GCCCGCCCGCGCCCCGGCCCCGG + Exonic
1127763641 15:62164607-62164629 GCCCGCCCGCGCCCCGGCCCCGG - Exonic
1128067925 15:64775763-64775785 CCGTGGGCTCGCCCCGGCCCCGG + Intergenic
1128153549 15:65377867-65377889 CGGAGCCCCAGCCCCGGCCCCGG - Exonic
1128269189 15:66293743-66293765 CCCCGTCCCCGCCCCCGCCCCGG - Intronic
1128743177 15:70097021-70097043 CCGCGCCCGCCGCCCGGCCCCGG - Exonic
1128743591 15:70098997-70099019 CCGCTCGCTCGCCCCGGCCCCGG + Intergenic
1128758835 15:70201097-70201119 CCGCCCCCTCGCCCAGGCCCAGG - Intergenic
1129082389 15:73052410-73052432 CCGCCCCCCCCCCCCCGCCCCGG + Intronic
1129468720 15:75738529-75738551 CCGTGCCCCCAGCCCGGCCCGGG - Intergenic
1129483027 15:75843129-75843151 GCGCGCCCCCGCCCCCGGCCTGG - Intergenic
1129612315 15:77070785-77070807 CGGCCCCCGCGCGCCCGCCCAGG + Intronic
1129675932 15:77632505-77632527 CCGAGCCCCGGCCCCGGCTCCGG - Intronic
1129675935 15:77632511-77632533 CCACTCCCGAGCCCCGGCCCCGG - Intronic
1129845014 15:78764185-78764207 CCAGGCCCACGCCCCAGCCCGGG + Intronic
1130076678 15:80695585-80695607 CGGCGCGTCCGCCCCGGCCCCGG + Exonic
1130540389 15:84817470-84817492 CCGCGCCCCAGCCCCGGCTGGGG - Exonic
1130540396 15:84817476-84817498 GCCCACCCGCGCCCCAGCCCCGG - Exonic
1131085894 15:89575551-89575573 CCGCCCCGGGGCCCCGGTCCGGG - Exonic
1131097481 15:89665746-89665768 CCCGGCGCGCCCCCCGGCCCGGG - Exonic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1132079490 15:98852345-98852367 CCGCGCCCGCGCCGCCGCCGTGG + Intronic
1132398265 15:101489635-101489657 CGCCGCCTGCGCCCGGGCCCCGG - Exonic
1202966415 15_KI270727v1_random:179693-179715 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1132464739 16:72356-72378 CCGCGACCCCTCCCCGGCCCCGG + Intronic
1132464741 16:72362-72384 CCCCTCCCCGGCCCCGGCCCCGG + Intronic
1132478424 16:153870-153892 CGGCCCCCGCCCCCCGTCCCAGG + Exonic
1132480509 16:164460-164482 CGGCCCCCGCCCCCCGTCCCAGG + Intronic
1132498656 16:275369-275391 GCGCGCACGCACCCCCGCCCCGG + Intronic
1132527979 16:426732-426754 CAGTTCCCACGCCCCGGCCCGGG - Intronic
1132583067 16:694151-694173 CCGCGCCCCCGGCCCAGCGCGGG - Exonic
1132583091 16:694219-694241 CCGCGCCCCCGCCCAGGTCATGG + Exonic
1132585767 16:705291-705313 CCGCGCCCCGGCCCCTGGCCCGG - Intronic
1132600015 16:769166-769188 CCCGGCCCCGGCCCCGGCCCCGG + Intergenic
1132600043 16:769214-769236 CCCGGCCCCGGCCCCGGCCCCGG + Intergenic
1132641855 16:981709-981731 CCGCGGCCCCGCCCCGCGCCCGG - Intergenic
1132658617 16:1051750-1051772 CCGCCCCCACGCCCAGACCCCGG - Intergenic
1132683452 16:1153026-1153048 CCCCGCCCCCGGCCCCGCCCCGG + Intergenic
1132692679 16:1188612-1188634 CCACGCCCGCGCCCAGGGGCCGG + Intronic
1132719504 16:1308975-1308997 TCCCGCCCGCGCCCCGGCCCAGG + Exonic
1132744776 16:1432077-1432099 CAGCGCCAGCACCCCTGCCCTGG + Intergenic
1132779353 16:1614312-1614334 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1132779357 16:1614318-1614340 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1132788319 16:1670551-1670573 CCAAGCCCTAGCCCCGGCCCCGG - Intronic
1132828987 16:1918434-1918456 CCGCGCCCGCTCCCAGGCTGCGG - Exonic
1132831349 16:1929889-1929911 ACGGTCCCGCGCCCGGGCCCGGG + Intergenic
1132843521 16:1989899-1989921 CCGCGCCCGCGCCCCCCACTGGG - Intronic
1132897745 16:2236967-2236989 ACGCCGCCCCGCCCCGGCCCGGG - Intronic
1132934971 16:2475437-2475459 GCTGGCCCGCGGCCCGGCCCAGG + Intronic
1132998461 16:2836626-2836648 CCGCACCCACCCCCCGGCCCAGG + Intronic
1133011021 16:2911966-2911988 CCGCGCGCGCGACCCCGCCGGGG - Intronic
1133032985 16:3020519-3020541 CGGCTCCCGAGCCCCGGCCCGGG - Intronic
1133201804 16:4208386-4208408 CCGCCCCCGCACCGCGACCCTGG + Intronic
1133286148 16:4691833-4691855 CAGCCCCCGCTCCCCTGCCCAGG + Intergenic
1134121403 16:11587026-11587048 CCGCCCCCGCGGCCCGCACCTGG + Intronic
1134441780 16:14302885-14302907 CCGCGTCCCCGCCCCCACCCCGG + Intergenic
1135335803 16:21599912-21599934 CCACGCCCCCGCCCCGGCCCCGG - Intronic
1135479924 16:22814079-22814101 CCGAGCCCGCGCCGCGCCCAGGG - Intergenic
1136141646 16:28292557-28292579 TGGCGCTCGGGCCCCGGCCCCGG - Exonic
1136428381 16:30183843-30183865 CTGCGCCCGCTACCTGGCCCCGG - Intronic
1136478258 16:30526453-30526475 CCGATCCCGCGACCCGGCCTCGG + Exonic
1136522422 16:30805676-30805698 CCGGGCCGGCGTCCGGGCCCAGG + Intergenic
1136590352 16:31214670-31214692 CCGCGCTCCCGGCCCAGCCCTGG - Intronic
1136779092 16:32885937-32885959 CCGCGCCCCCGGCCCCGACCGGG + Intergenic
1136861550 16:33707235-33707257 CCGCGCCTGCGCCGCCGCCGTGG + Intergenic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1136891525 16:33975581-33975603 CCGCGCCCCCGGCCCCGGCCGGG - Intergenic
1136923372 16:34350240-34350262 CCGCGGCCGCCCCCCGCACCAGG + Intergenic
1136981201 16:35061566-35061588 CCGCGGCCGCCCCCCGCACCAGG - Intergenic
1137054254 16:35735823-35735845 CTGCGCCCCTGCCGCGGCCCAGG + Intergenic
1137261154 16:46831054-46831076 CCGCCCGCGCGCCCGGCCCCCGG + Intronic
1137300254 16:47142989-47143011 CGGCGCCCGCGCGCCGCCCCCGG + Intronic
1137531620 16:49281916-49281938 CCCTGCCCCCGCCCCGGCCGAGG + Intergenic
1137559247 16:49492475-49492497 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1137665283 16:50246058-50246080 CCGCCCCCGCGCCCCAGGCCTGG + Intergenic
1137708005 16:50548587-50548609 CCCCGCCCGCGCGCTCGCCCCGG + Intronic
1137787598 16:51151362-51151384 CCTCCCCGGCTCCCCGGCCCCGG + Intronic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1138514473 16:57528574-57528596 CCCCGCCCGCGCCGCGCACCTGG + Exonic
1139489563 16:67279201-67279223 CCGTGCCCACTCCCCGGGCCTGG - Exonic
1139509175 16:67416545-67416567 CCGCGCCGGTCCCCCGGCCAGGG + Intronic
1139546738 16:67653193-67653215 GCGCGGCCGCGGCCGGGCCCGGG - Exonic
1139754581 16:69132367-69132389 CCGCGCGCCCCGCCCGGCCCCGG + Intronic
1140078516 16:71723558-71723580 CCGCGCCCGCGTCCAGGCCTCGG - Intronic
1140221626 16:73048162-73048184 CCCCGCCCGCCCCCCTTCCCCGG - Exonic
1140462244 16:75148959-75148981 CCGCGCGCGCGCGCCCGCCGGGG - Intronic
1141972253 16:87492264-87492286 CCCCGCGCGGTCCCCGGCCCCGG - Intergenic
1141972431 16:87492712-87492734 CGCCGCCCGCGCCTCCGCCCAGG + Intergenic
1142009308 16:87705788-87705810 CCCCGCCCCCGCCCCCGCCCAGG - Intronic
1142125000 16:88405794-88405816 CCCAGCCCGCCCCACGGCCCAGG + Intergenic
1142156205 16:88533861-88533883 CCGCGCTCGTCCCCGGGCCCCGG + Exonic
1203081507 16_KI270728v1_random:1148025-1148047 CCGCGCCCCCGGCCCCGGCCGGG + Intergenic
1142549915 17:732344-732366 ACGCGCGCGCGCCGCGGCCCCGG + Intergenic
1142623712 17:1179877-1179899 CCCCGCCCTCGCCCCTGCCCCGG - Intronic
1142695014 17:1628743-1628765 CTGCCCCCGCGCCCTCGCCCCGG + Intronic
1142764007 17:2055902-2055924 CCCCACCCGCGTCCCGGCCTCGG - Intronic
1142799775 17:2337813-2337835 CCGCGCCCACCCCCCGGCGCGGG + Intronic
1142811946 17:2399644-2399666 CCCCGCCCAGGCCCCGCCCCCGG + Intronic
1142855105 17:2724703-2724725 CAGGCCCCGCGCCCGGGCCCCGG - Intergenic
1142876290 17:2853641-2853663 CGCCTCCCGCGCCCCGGCCTCGG - Intronic
1143099814 17:4498911-4498933 CGGCTCCTGCGCTCCGGCCCCGG - Exonic
1143119649 17:4598935-4598957 CCCGGCCCCAGCCCCGGCCCTGG + Intronic
1143150870 17:4807139-4807161 CGGAGCCCACGCCCCGGCCGAGG - Exonic
1143390512 17:6556675-6556697 GCGGGCCCGCACCCCCGCCCCGG + Intergenic
1143498627 17:7326406-7326428 CTGCACCCCCGCCCCTGCCCGGG + Intronic
1143519205 17:7436132-7436154 CCACGCCCCCGCCCCCGCCCCGG + Intronic
1143519208 17:7436138-7436160 CCCCGCCCCCGCCCCGGCTTTGG + Intronic
1143598443 17:7929344-7929366 CCGCCCCCGGGGCCCGGCCGGGG + Exonic
1143608080 17:8002619-8002641 CCACGCCCCCGCCCTGGCCTGGG + Exonic
1143783243 17:9240270-9240292 CGGCGGCCGCGCCCAGGCCCAGG - Exonic
1144586905 17:16492418-16492440 TCGCCCCCGCGCCACGGCCCCGG - Intergenic
1144775728 17:17783697-17783719 CCTCGCCCCCGCCCCGGATCTGG + Intronic
1144847111 17:18225776-18225798 TCCCGCCCGAGCCCGGGCCCGGG - Intronic
1144851691 17:18247134-18247156 CCCCCCCCGCGCCCCGGTCCCGG + Intronic
1144963632 17:19061563-19061585 GCGAGCCCACGCCCAGGCCCAGG - Intergenic
1144964046 17:19064463-19064485 GCGAGCCCACGCCCAGGCCCAGG + Intergenic
1144971527 17:19112963-19112985 GCGAGCCCACGCCCAGGCCCAGG + Intergenic
1144983908 17:19187667-19187689 GCGAGCCCACGCCCAGGCCCAGG - Intergenic
1144984317 17:19190572-19190594 GCGAGCCCACGCCCAGGCCCAGG + Intergenic
1145049533 17:19648649-19648671 CCCCGCCCTCTCCCCGGCTCTGG - Intronic
1145243522 17:21253049-21253071 GCGCGCCCGCGGCCCGGCTCCGG - Intronic
1145912911 17:28552670-28552692 CCCCGCCCCGGCCCCGCCCCTGG + Intronic
1146229466 17:31095240-31095262 CCCCGCCCTCTTCCCGGCCCAGG + Exonic
1146445220 17:32927910-32927932 CCCTGCCTGCGCCCCGCCCCGGG - Intronic
1146919996 17:36704003-36704025 GCGCGCCCCAGCCCCGCCCCGGG + Intergenic
1146935126 17:36808429-36808451 CGGCGCCGGCGCCCTGGCCAAGG - Intergenic
1146955862 17:36936118-36936140 CCGCGCCGGCGCCGCGCCTCCGG + Intergenic
1147184387 17:38705593-38705615 CCGGCCCCCCGCCCCAGCCCCGG + Exonic
1147200702 17:38799597-38799619 CCGCCCTCCCGCCCCGCCCCGGG + Exonic
1147311603 17:39599117-39599139 CCGCGCCCCAGCCTCGGCCTGGG + Intergenic
1147440282 17:40443488-40443510 CCGCATCCTCGGCCCGGCCCAGG - Exonic
1147440347 17:40443707-40443729 CCGCGCCCGCGCCCAGTCCTCGG + Exonic
1147617175 17:41836297-41836319 CCCCACCCCCGCCCCGCCCCCGG - Intronic
1147720395 17:42536314-42536336 CCGCGCCCCCGGCCCCGGCCAGG - Exonic
1147890593 17:43713972-43713994 CCGCGCCCGCCCCCCGCGCCGGG - Intergenic
1147970973 17:44219078-44219100 CCCCGCCGGCGCCCCCGCCCCGG + Intronic
1148048717 17:44759082-44759104 CCGGCCCCGCGCCCCCGCCCCGG + Exonic
1148122667 17:45222024-45222046 CTGCCCCCTCGCCCCCGCCCGGG + Exonic
1148178025 17:45584702-45584724 CAGCACCAGCGCCCCGGCCGGGG - Intergenic
1148323700 17:46771690-46771712 CCGCGGCCGGGCCGCGCCCCCGG + Intronic
1148629066 17:49092606-49092628 CCCCACCCCCGCCCCAGCCCAGG - Intergenic
1148733438 17:49851394-49851416 CCGCGGCCGCGACCCGCCCCCGG - Intergenic
1148818226 17:50345998-50346020 CCCCGCCCCCGGCCCCGCCCCGG + Intergenic
1148930082 17:51120764-51120786 CCCAGCCCCAGCCCCGGCCCGGG - Exonic
1149614818 17:57988445-57988467 CCGCGCCCCATCCCCGCCCCGGG - Intergenic
1149678586 17:58488093-58488115 CCGCCACCGCCCCCCGGCCCGGG + Exonic
1149772408 17:59331988-59332010 CGGCGGCCGCTCCCCGTCCCCGG - Intronic
1149833678 17:59893364-59893386 CTGAGCCCGCGCCGCCGCCCCGG - Intronic
1150133321 17:62680727-62680749 CCGCGCCCGCCTCCGGGGCCTGG + Intronic
1150217083 17:63476921-63476943 CCCGGCCCGCGCCCCTGCCCGGG + Intergenic
1150217205 17:63477351-63477373 CCCCGCCCCCGCCCGGGCCCGGG - Intergenic
1150239942 17:63622915-63622937 CCGCTCGCGCGCCGCGGCCCGGG + Intronic
1150250032 17:63700041-63700063 CCGATCCCGCCCCGCGGCCCAGG - Exonic
1150285234 17:63950431-63950453 CCAGGCCCCGGCCCCGGCCCCGG + Intronic
1150388792 17:64779543-64779565 AGGAGCCTGCGCCCCGGCCCCGG + Intergenic
1150407913 17:64918988-64919010 CAGCACCAGCGCCCCGGCCGGGG - Intronic
1150488888 17:65561298-65561320 CCCCGCCCGCGCCCCCCTCCAGG + Intronic
1150638255 17:66931713-66931735 CCGCGCCCGCCCCCCAACCCCGG - Intergenic
1150747313 17:67825979-67826001 CAGCACCAGCGCCCCGGGCCGGG + Exonic
1150791876 17:68205725-68205747 CTGCGCCCCGGCCCCTGCCCCGG + Intergenic
1150802435 17:68292217-68292239 GTGCGCGCGCGCCCCGGGCCGGG - Intronic
1150823833 17:68457482-68457504 CCGCGCCGGCTCCACGGGCCGGG + Intronic
1151438473 17:74113398-74113420 CCCCGCCCCCGCCCCCGCCGTGG - Intergenic
1151801993 17:76384324-76384346 CTGCGCTCGCGGCCGGGCCCGGG + Intronic
1151857912 17:76736520-76736542 CCGCCCGCGCGCTCCCGCCCAGG + Exonic
1151919228 17:77141135-77141157 GTGCGCCCTCGCCCCGGTCCCGG + Intronic
1152049301 17:77959436-77959458 GCACACACGCGCCCCGGCCCCGG - Intergenic
1152175165 17:78782362-78782384 CTGCGCCCGCCCCCTGCCCCCGG + Intergenic
1152303626 17:79509113-79509135 CAGCCCCAGGGCCCCGGCCCTGG + Intronic
1152349692 17:79777925-79777947 CCCCGCCCCCGCCCCCGCCCGGG + Intergenic
1152396303 17:80035759-80035781 CCGCCCCCGCGGCCCCGTCCGGG + Intronic
1152433274 17:80260926-80260948 CCTAGCCCGCTCCCCGCCCCGGG - Intronic
1152552197 17:81035397-81035419 CCGGGGCCGCGCGCCGGGCCAGG + Intronic
1152617763 17:81345817-81345839 CCGCGTCCTCTCCCCGGCCACGG + Intergenic
1152625660 17:81386944-81386966 TCGCCGCCGCGCCCCGCCCCCGG - Intergenic
1152627287 17:81393572-81393594 CCGCGGCCGAGCCCCTGGCCAGG - Intergenic
1152718520 17:81911291-81911313 GCGCGCCTGCCCCCCGGGCCCGG + Exonic
1152729058 17:81961032-81961054 CCGCTCCCGCCCGCCGGGCCTGG + Exonic
1152737274 17:82003754-82003776 CAGAGCCCGCGCCCACGCCCTGG + Intronic
1152748405 17:82051620-82051642 CCCCGCGCGCGCCCCCGTCCCGG - Exonic
1152758847 17:82098088-82098110 CCGCGCCCCGGCCCCAGCGCCGG + Intronic
1152820451 17:82435228-82435250 CCGCACCTGCCCCCAGGCCCCGG + Intronic
1152864904 17:82716726-82716748 CCGCGGCCGCGGACCCGCCCCGG - Exonic
1152924487 17:83080866-83080888 CCCCGCCCCCGCCCCCGCCGCGG + Intronic
1153469482 18:5427986-5428008 CCACGCCCCCACCCCGCCCCCGG + Intronic
1154070652 18:11149114-11149136 CCGCGCTCTGGCCTCGGCCCCGG + Intergenic
1154125606 18:11689656-11689678 GCCCGCCCCGGCCCCGGCCCTGG + Exonic
1154210774 18:12377106-12377128 CCGCGCCTGCGCAGCGTCCCGGG - Exonic
1154304164 18:13218321-13218343 CCCCGCCCGCGGGCCAGCCCCGG - Intronic
1154304253 18:13218633-13218655 CACCGCGCGCTCCCCGGCCCCGG + Intronic
1155054617 18:22172236-22172258 CCGCGCCGGAGCCCCGCTCCCGG + Exonic
1155209231 18:23586565-23586587 TCGCGGCGGCGCCCCAGCCCGGG - Exonic
1155300718 18:24426700-24426722 CCGCCCCCGCGCTCCGGACCTGG + Exonic
1156249969 18:35343851-35343873 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1156448593 18:37254055-37254077 CCCCGCCCCCGGCCCCGCCCCGG + Intronic
1157279104 18:46334192-46334214 CGCCGCCCGCGCCCGCGCCCCGG + Intronic
1157384094 18:47247594-47247616 CCGAGGCCGCGCCCCCGCCGGGG - Intronic
1157529535 18:48409498-48409520 CCGCGCCCGCGCCGCCGGCTCGG + Intronic
1158137675 18:54224424-54224446 CAGCGCGCTCGCCCCGTCCCCGG - Exonic
1159586759 18:70289308-70289330 CGGCCCCCGTTCCCCGGCCCTGG - Intronic
1159586785 18:70289369-70289391 GGGCCGCCGCGCCCCGGCCCCGG - Intronic
1159773970 18:72583073-72583095 CTGGGCCCGGGCCCAGGCCCAGG + Intronic
1159798080 18:72867707-72867729 CCTCTCCCCGGCCCCGGCCCCGG - Exonic
1159798083 18:72867713-72867735 CTGCGCCCTCTCCCCGGCCCCGG - Exonic
1160025360 18:75211572-75211594 CTGCGCCCGCGGCCCGCGCCGGG + Intronic
1160157016 18:76441944-76441966 CCGCACGCGCGCCCCGGCCGAGG - Exonic
1160163210 18:76491269-76491291 CCCCTCCCCGGCCCCGGCCCCGG + Intronic
1160163215 18:76491275-76491297 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1160499179 18:79394113-79394135 GGCCGCCCCCGCCCCGGCCCCGG + Intergenic
1160500783 18:79400358-79400380 CCCGGCTCCCGCCCCGGCCCCGG + Intronic
1160631205 18:80247418-80247440 GCGCCCCCAGGCCCCGGCCCCGG + Exonic
1160631210 18:80247424-80247446 CCAGGCCCCGGCCCCGGCCCCGG + Exonic
1160675868 19:390949-390971 CCCCGCCCCGGCCCCCGCCCTGG + Intergenic
1160691055 19:460846-460868 CCGCCGCCGGGCCGCGGCCCAGG + Exonic
1160724848 19:613559-613581 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1160766693 19:811947-811969 CCGCCCCCGCGTCCTGTCCCGGG + Exonic
1160781141 19:878429-878451 CCCAGCCCCGGCCCCGGCCCCGG + Intronic
1160781300 19:878919-878941 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1160781304 19:878925-878947 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1160831128 19:1105292-1105314 CCGACCCCGCGCCCCACCCCAGG - Intronic
1160835440 19:1122624-1122646 CCGCTCCCGCCCCCTGCCCCAGG + Intronic
1160861070 19:1237453-1237475 CCGCGCCCCCGAGCCGGCCAAGG + Intronic
1160861287 19:1238117-1238139 CGGCGGCCGAGCCCCGCCCCCGG + Intergenic
1160887993 19:1360900-1360922 CTGGGCCCTGGCCCCGGCCCGGG - Exonic
1160909280 19:1467432-1467454 GCCCGCCCCGGCCCCGGCCCAGG + Exonic
1160919480 19:1513087-1513109 CCGCAGGCGCGCCCAGGCCCGGG + Exonic
1160947873 19:1652013-1652035 CGCCCCCCGCGCCCCCGCCCGGG + Intronic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1160992208 19:1864415-1864437 CCGCGCCCGCGGCGGGGCCCGGG + Intergenic
1160994753 19:1877477-1877499 CCCCGCCCCCGTCCCCGCCCGGG + Intronic
1161065642 19:2236088-2236110 CCCCGCCCAGACCCCGGCCCCGG + Intronic
1161099956 19:2416583-2416605 CCGGGCTCCCGCCCAGGCCCAGG - Exonic
1161215811 19:3094586-3094608 CCCGGCCCCCGGCCCGGCCCTGG - Exonic
1161222029 19:3122309-3122331 CCGCCCCCGAGCGCCGCCCCCGG + Exonic
1161265030 19:3359992-3360014 CCGGGCCCCCGCCCCCTCCCCGG + Intronic
1161425036 19:4198540-4198562 CCGCTCCTGCGCCCCCTCCCCGG - Intronic
1161505079 19:4639507-4639529 CCCCGCCCCGGCCCCGGCCCCGG + Intronic
1161560299 19:4969287-4969309 CCGCCCCCGCGTCGCGGCTCGGG + Intronic
1161770643 19:6228961-6228983 CCGCGCCTCCTCCCCGCCCCTGG + Intronic
1161800730 19:6415644-6415666 CAGCCCCCGGGCCCCGTCCCCGG - Exonic
1161925338 19:7294915-7294937 CCGCGAGTGCGCCCCGGCCCAGG + Intergenic
1162019764 19:7863081-7863103 CCGCCCCCGCCCCCCGACCCCGG - Intronic
1162021190 19:7869363-7869385 CCGCGAGGACGCCCCGGCCCCGG + Exonic
1162079356 19:8209297-8209319 CCGCCCCCACGGCCCCGCCCCGG + Intronic
1162113279 19:8413069-8413091 CCCCGCCCCAGCCCCGCCCCAGG - Intronic
1162398791 19:10432448-10432470 CAGCGCCCCGGGCCCGGCCCCGG + Intronic
1162457898 19:10796836-10796858 CCGCGCCAACGCCGCGGGCCTGG + Intronic
1162470919 19:10871651-10871673 CCGCCGCTGCGCCCGGGCCCAGG - Exonic
1162490059 19:10986533-10986555 CCTGGCCCTGGCCCCGGCCCGGG + Exonic
1162524140 19:11197639-11197661 CCGCCCGGGCGCCCCGGCCGCGG + Intronic
1162659197 19:12156311-12156333 CCCGGCCCTGGCCCCGGCCCCGG - Intronic
1162772407 19:12957106-12957128 CCGCCCCCGCGCCGCAGGCCGGG - Exonic
1162778744 19:12995889-12995911 CCGCGCCCGCTCCCCTCCCCCGG - Intronic
1162779954 19:13001891-13001913 CCCCGCCCGTGCCCCTGGCCTGG + Intronic
1162802269 19:13118183-13118205 CCCCGCCCGCGCACCGCCCTCGG - Intronic
1162901016 19:13795617-13795639 CCCCGCCCCGGCCCTGGCCCCGG + Exonic
1163148639 19:15398681-15398703 CCTCGCCGGCGCCCGGCCCCTGG - Intronic
1163154454 19:15432451-15432473 GCGGGCCCGGGCCCCGGCTCCGG + Intronic
1163158038 19:15449681-15449703 CCCCGCCCCCGCCCCCGCCCCGG + Intronic
1163329620 19:16628099-16628121 CCGGGACCGAGACCCGGCCCCGG - Exonic
1163370328 19:16897679-16897701 CCGCGCACTCACCCGGGCCCCGG + Exonic
1163370378 19:16897858-16897880 GCGCGCCCGCACCCCCGGCCCGG - Intronic
1163390299 19:17026697-17026719 CCGCGCTCGGACCCTGGCCCTGG - Exonic
1163453765 19:17394127-17394149 GCACGCCCGGGCTCCGGCCCCGG + Intergenic
1163547230 19:17947796-17947818 CCTAGCCCCGGCCCCGGCCCCGG + Intergenic
1163575706 19:18109888-18109910 CTCTGCCCTCGCCCCGGCCCTGG - Intronic
1163583008 19:18149395-18149417 GCTCGCCCTCGCCCCTGCCCGGG + Exonic
1163698525 19:18775828-18775850 CCGCACACGCGCCCCCGGCCTGG - Intronic
1164615776 19:29665947-29665969 CCCCCGCCGCGCCCCTGCCCAGG - Intronic
1164648146 19:29873761-29873783 CCGCGCCCGCGCCGCTCTCCCGG + Intergenic
1165058572 19:33194290-33194312 CCTCGCCCGCGCCCGGAGCCTGG - Intronic
1165154196 19:33777477-33777499 CCACACCCCCTCCCCGGCCCGGG - Intergenic
1165349734 19:35269184-35269206 GTGCCCCCGCGCCCCGGCCCCGG + Intronic
1165349739 19:35269190-35269212 CCGCGCCCCGGCCCCGGCCCCGG + Intronic
1165349788 19:35269308-35269330 CCGCCCCCGGCCCCCGGCCTCGG + Intronic
1165459512 19:35936458-35936480 CCCGGCCCCCGCCTCGGCCCCGG + Intronic
1165751725 19:38264445-38264467 GCGCGGCCGCTCCCCGGCCCTGG - Exonic
1165774295 19:38395726-38395748 GCTCGCCCACCCCCCGGCCCGGG + Exonic
1166105964 19:40598206-40598228 CCCCGCCCCCGCCGCGGCTCGGG - Intronic
1166107604 19:40605138-40605160 GGGCGCCCGGCCCCCGGCCCCGG + Exonic
1166139661 19:40799306-40799328 TCGCGCCGGCGCCCCGGCTCCGG - Intronic
1166305155 19:41933101-41933123 TCGCGCCCTCGGCCTGGCCCTGG - Intergenic
1166375692 19:42325747-42325769 ACCCGCTCGCGCCCCGCCCCCGG + Intronic
1166547050 19:43639901-43639923 CCCCGGCCCCGCCCCGGCCTCGG - Intergenic
1166673451 19:44725221-44725243 CCCCGCCCCCGCCCCTGACCTGG + Intergenic
1166727805 19:45039267-45039289 CCGAGCCCGTGCCCCGGCTGTGG + Intronic
1166731889 19:45064045-45064067 CCGCTCCCGCTCCCCGACCCCGG + Exonic
1166853633 19:45771735-45771757 CCGCATCCCGGCCCCGGCCCCGG + Intronic
1166869825 19:45864415-45864437 ACCCGCCCCCGCTCCGGCCCCGG - Exonic
1167040471 19:47020376-47020398 CGGCGCGCGAGCCCCAGCCCCGG - Intronic
1167368087 19:49065073-49065095 CCCCGCCCCCGCCCCCGACCCGG - Intronic
1167469176 19:49665959-49665981 CCGCGCCTGCGCACTGGGCCGGG - Exonic
1167622754 19:50568339-50568361 CCCCCCCCAGGCCCCGGCCCCGG + Intergenic
1167622761 19:50568345-50568367 CCAGGCCCCGGCCCCGGCCCCGG + Intergenic
1167738758 19:51311858-51311880 CTGCGCCCGGGGCCCGGCTCCGG + Exonic
1167921466 19:52786346-52786368 CGGCGCCCCGGCCCCAGCCCCGG - Intronic
1168076437 19:53982879-53982901 GCGCGCCCGCGCACGCGCCCCGG - Exonic
1168151134 19:54449457-54449479 CTGCGCCTGCGCACCGGGCCTGG + Intronic
1168239534 19:55082198-55082220 TCGTGCCCGCGCCCCGGCCCAGG - Intronic
1168344537 19:55643844-55643866 CCCCACTCCCGCCCCGGCCCAGG - Intronic
1168351029 19:55675491-55675513 GCCCGCGCGCGCCGCGGCCCAGG - Intronic
1168536023 19:57171917-57171939 CCGCTCGCGCCCCCCGGCCCGGG - Intergenic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
1168719039 19:58544814-58544836 CGGAGCCCTCGCCCGGGCCCGGG - Exonic
924962321 2:46133-46155 CCCGGCCCGCGCCCCGGCCCCGG - Exonic
925068866 2:950881-950903 CCGCGCCCGCGCCCCTCTGCCGG - Exonic
925169541 2:1742810-1742832 TCGGGCCCCCGCCCCGCCCCAGG + Intronic
926095694 2:10079828-10079850 GCGCGTCCCCGCCCCAGCCCTGG - Intronic
926154937 2:10448428-10448450 CCGGGCCCCCGCCCCTCCCCCGG - Exonic
926202650 2:10812771-10812793 CCGCGCCCACGTCCCGCCCCAGG + Intronic
926285156 2:11482542-11482564 CCGGGTTCGCGCCCCGGGCCTGG - Intergenic
926801845 2:16665930-16665952 CAGCCGCCCCGCCCCGGCCCCGG + Intronic
926914316 2:17878409-17878431 CCGGCCGCGCGCCCCCGCCCAGG - Intronic
927633429 2:24793645-24793667 CCGCGCCCATCCCGCGGCCCCGG - Intronic
927713788 2:25340849-25340871 CGGCCCCCGCGGCCCGGGCCCGG + Intronic
927713793 2:25340855-25340877 CCGGGCCCGGGCCCGGGCCGCGG - Intronic
927751261 2:25673089-25673111 CCCCGCTCGCGCCCGTGCCCCGG + Intronic
927881491 2:26692818-26692840 CCCGGCCCGCGCCTCGGCCCCGG - Exonic
927958552 2:27225089-27225111 CCGAGCCAGCACCCCGGCCTTGG - Exonic
929033705 2:37671800-37671822 CCGCGCGCGCGCCCGGCCACCGG - Exonic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929452816 2:42048145-42048167 CGGCTCCCCGGCCCCGGCCCCGG - Exonic
929510113 2:42559798-42559820 CCCTGCCCGCCCCCCGCCCCGGG - Intronic
929966817 2:46542768-46542790 CGGCGCCCGCGCCCTCTCCCCGG - Exonic
929966838 2:46542821-46542843 CCGGATCCCCGCCCCGGCCCCGG - Exonic
929966910 2:46542990-46543012 CGGAGCCCCCGCCCCGGCCCCGG - Exonic
930700680 2:54456264-54456286 CCGCGCTCCCGCCCAGCCCCCGG + Exonic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
932343002 2:70978579-70978601 ACCCGCCGGCGCCCCGCCCCCGG - Intronic
932621778 2:73269098-73269120 CCGCCGCCTGGCCCCGGCCCCGG - Exonic
932699976 2:73985402-73985424 CCGCGCGCGCGCCGCCGCTCGGG - Intergenic
932780048 2:74554121-74554143 CCGCGCCCCCTCCCCCTCCCTGG + Exonic
932812014 2:74833923-74833945 CCTCCCCCGCCCCCCGCCCCCGG + Intergenic
933666878 2:84971325-84971347 CCGCCCCCGCGGCCGAGCCCGGG + Exonic
934539140 2:95159819-95159841 CCGCGCCAGCACCCCGCCACCGG - Intronic
934754480 2:96816092-96816114 CCACGCCCCCGGCCCGCCCCTGG + Intergenic
934933223 2:98445138-98445160 CCGCGCCCGCTGTCCGTCCCCGG - Intronic
935112284 2:100104723-100104745 CCGCCGCCGCCCCCCGCCCCCGG + Intronic
935595332 2:104873427-104873449 CCGTGAGCGCGCCCCAGCCCTGG + Intergenic
935692544 2:105744681-105744703 CCGCGCCCGGGTCCCGGTACGGG - Intergenic
936427359 2:112433044-112433066 CGGCGGCCTCGACCCGGCCCGGG - Intronic
936452837 2:112646169-112646191 CGGCGTCCGCGCCCGGCCCCGGG - Intronic
936996760 2:118423938-118423960 CTGAGCCCGCACCCCTGCCCTGG - Intergenic
937081473 2:119143185-119143207 CCCCGCCCTGGCCCAGGCCCCGG - Intergenic
937134926 2:119544403-119544425 TCGCGCCCGGCCGCCGGCCCTGG + Intergenic
937283778 2:120737177-120737199 CCCCGCCCCCGCCCCGTCCGGGG - Intronic
937951076 2:127388186-127388208 CCCCGCCCCCGCCCCTGCCCCGG + Intronic
938073075 2:128318570-128318592 CCGCGCCCGGGCCCCGGCGATGG - Exonic
938455573 2:131460717-131460739 CGGCGCCCGCGCCCTCTCCCCGG - Intergenic
938455667 2:131460942-131460964 CGGAGCCCCCGCCCCGGCCCCGG - Intergenic
938796132 2:134719214-134719236 CGGCTCCCGCGCCCGGGCCTTGG - Intergenic
940316707 2:152335109-152335131 CGGCGCCCGGCCCCCGCCCCCGG - Intergenic
941111605 2:161423516-161423538 CGGGGCCCGCGCCCGCGCCCGGG - Exonic
941385068 2:164841891-164841913 CAGCGCCCGCACCCCGCCCGCGG - Intronic
941666359 2:168247288-168247310 CCCGGCCCCGGCCCCGGCCCCGG - Exonic
941951329 2:171160257-171160279 CCGCGCCCGCGCCCGCTCGCGGG - Intronic
941951467 2:171160734-171160756 CTCCGCCCGCGCTCCGACCCCGG - Exonic
943060469 2:183037854-183037876 CGCCGCCCGAGGCCCGGCCCGGG - Intronic
944206712 2:197164616-197164638 CCGCGCCCCAACCCCTGCCCCGG + Intronic
944495864 2:200306867-200306889 GCGCCCCCGGGCCCCGGCTCCGG + Intronic
944495870 2:200306873-200306895 CCGGGCCCCGGCTCCGGCCCGGG + Intronic
944675871 2:202033946-202033968 TCGTGCCCGCGGCCTGGCCCCGG - Intergenic
944676016 2:202034511-202034533 CGCCGCCCACGGCCCGGCCCCGG + Intergenic
945245255 2:207711710-207711732 CCCGCCCCGCGGCCCGGCCCCGG - Intronic
946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG + Intronic
946327671 2:218993149-218993171 CAGCGCCCCCGCGCCGGGCCCGG - Exonic
946404059 2:219483525-219483547 CAGCTCCCGCGGCCCGGCCCGGG - Exonic
946404076 2:219483587-219483609 CAGCGCCGGAGCCCCAGCCCGGG + Exonic
947593030 2:231395842-231395864 CCGGGCCCACGCCCCCGCCCAGG - Intronic
948046868 2:234951958-234951980 CCCCGCCCCCGCCCCCGCCCAGG + Intronic
948046874 2:234951964-234951986 CCCCGCCCCCGCCCAGGCGCGGG + Intronic
948115728 2:235493712-235493734 CGGCCCCCGCGCCCCGGCACGGG - Intergenic
948190533 2:236054864-236054886 CCGGGCCCGGGCCCCCTCCCCGG + Intronic
948192496 2:236070761-236070783 CCCCGCCCCTGCCCCGGCCCAGG - Intronic
948205198 2:236159773-236159795 CCGCCCCCCCACCCCGGGCCCGG + Intergenic
948216541 2:236237342-236237364 CCCGCCCCGCGCCCCGGCCCCGG - Intronic
948216556 2:236237367-236237389 CCCGCCCCGCGCCCCGGCCCCGG - Intronic
948216571 2:236237392-236237414 CCCGCCCCGCGCCCCGGCCCCGG - Intronic
948216585 2:236237417-236237439 CTCGCCCCGCGCCCCGGCCCCGG - Intronic
948393336 2:237627568-237627590 CCCCGGCCCGGCCCCGGCCCCGG - Intronic
948645221 2:239400431-239400453 CCACCCCCGCGCCCCCGCCCCGG + Exonic
948697315 2:239738210-239738232 CCCGGCCCCGGCCCCGGCCCCGG + Intergenic
948697319 2:239738216-239738238 CCCGGCCCCGGCCCCGGCCCCGG + Intergenic
948697370 2:239738319-239738341 CCCGGCCCCAGCCCCGGCCCAGG + Intergenic
948844217 2:240675550-240675572 CAGCCCCAGCGCCCCTGCCCGGG + Intergenic
948849643 2:240699329-240699351 CAGCCCCAGCGCCCCTGCCCGGG - Intergenic
948943436 2:241207649-241207671 CAGCGCCTGTGCCCTGGCCCAGG + Exonic
948983831 2:241508362-241508384 CCGCCACCGAGCCCCGCCCCGGG + Intronic
949012138 2:241686908-241686930 CGTCGTCCTCGCCCCGGCCCCGG - Exonic
1168765758 20:380966-380988 GCGCGCCCGGCCCCCGGTCCGGG - Exonic
1168769797 20:408018-408040 CCCCGCCCCCGGCCCCGCCCCGG + Intronic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1169065483 20:2692619-2692641 CCGCCCCGCCGCCGCGGCCCGGG + Intergenic
1169065487 20:2692624-2692646 CCGCCGCCGCGGCCCGGGCCCGG + Intergenic
1169065577 20:2692839-2692861 CCGGGCCCGAGGCCAGGCCCCGG + Intergenic
1169262512 20:4148983-4149005 GTGCGCCCGCTCTCCGGCCCCGG + Intronic
1169673871 20:8132767-8132789 CCGAGCCAGCGCCCCGACTCGGG - Intronic
1170026073 20:11891016-11891038 CAGGGCGCGCGCCCCTGCCCGGG - Intronic
1170156616 20:13274671-13274693 CCCCCCCCGCGCCCGGCCCCCGG + Intronic
1170629771 20:18056962-18056984 CCGCCGCCCCGCCCCGGACCTGG + Intronic
1171011328 20:21510870-21510892 CCCCGCCCGCCCCAGGGCCCCGG + Intergenic
1171452840 20:25248027-25248049 CCGCGCCTGCGCGCCGCGCCGGG - Intergenic
1171484346 20:25476599-25476621 CCCGGCCCCCGCCCCTGCCCCGG - Exonic
1172100931 20:32483642-32483664 CCCCGCCCCCGCCCCGTGCCCGG - Intronic
1172533507 20:35652816-35652838 CCCGGCCCCGGCCCCGGCCCTGG - Exonic
1172533510 20:35652822-35652844 CCTGGCCCCGGCCCCGGCCCCGG - Exonic
1172596568 20:36154624-36154646 CCCCGCCCCCGCCCCGGCCTCGG - Intronic
1172618705 20:36306395-36306417 CCCGGCCCCCGCCCCGGCTCCGG - Exonic
1172666809 20:36605914-36605936 GCGCGCCCCAGGCCCGGCCCGGG + Exonic
1172764928 20:37346234-37346256 GCCCGCCCGCCCGCCGGCCCAGG + Exonic
1172773131 20:37393030-37393052 CCCCGCTCCCGCCCAGGCCCAGG + Intronic
1173251484 20:41366312-41366334 CCGGGGCCGAGCCCCTGCCCAGG - Intronic
1173576644 20:44116297-44116319 CTGCGCCGGCGCCCCGGTCGGGG + Exonic
1174246720 20:49187785-49187807 CCCCGCCTGCGCCCCAGCCCCGG + Intronic
1174494547 20:50930720-50930742 ATGCGCCCGCGCCCGGGGCCAGG + Intronic
1174579583 20:51562376-51562398 GGGCGCCCGCGCCCCGGCCAGGG - Intronic
1175429597 20:58891935-58891957 CCGAGCCCGCCCCCCGCCCCGGG + Intronic
1175531412 20:59675937-59675959 CCGGGCCCAGGCCCAGGCCCAGG - Intronic
1175847183 20:62065257-62065279 CCCGGCCCCGGCCCCGGCCCTGG - Exonic
1175847187 20:62065263-62065285 CCCGGCCCCGGCCCCGGCCCCGG - Exonic
1176005577 20:62860952-62860974 CTCCGCCCCGGCCCCGGCCCCGG + Intronic
1176068846 20:63215814-63215836 CAGACCCCGCGCCTCGGCCCCGG + Intronic
1176068850 20:63215820-63215842 CCGCGCCTCGGCCCCGGCCGCGG + Intronic
1176093107 20:63327613-63327635 CCCCTCCCGGGCCCCGGGCCCGG - Intronic
1176143203 20:63554082-63554104 CCCCACCCCCGCCCCGCCCCCGG + Exonic
1176194575 20:63831304-63831326 GCGCGCGCGCGCCCCGCCCGCGG + Intergenic
1176207215 20:63895493-63895515 CCGCGCCCCCGCCCCGGCCCAGG - Intronic
1176221029 20:63969524-63969546 CCGCGCCCGCTCCCGGCCCCAGG - Intronic
1176232274 20:64038563-64038585 CCCCGCGCCCGGCCCGGCCCGGG - Intronic
1176286697 21:5022466-5022488 CCCCGTCCCCGCCCCGCCCCCGG - Intergenic
1176547782 21:8208965-8208987 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176547801 21:8209002-8209024 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1176548057 21:8209887-8209909 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176549493 21:8214998-8215020 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1176555693 21:8253204-8253226 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1176555950 21:8254097-8254119 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176557388 21:8259227-8259249 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1176566724 21:8392003-8392025 CCGGGGCCGAGGCCCGGCCCGGG - Intergenic
1176566988 21:8392922-8392944 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176568418 21:8398032-8398054 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1176574608 21:8436199-8436221 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176574627 21:8436236-8436258 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1176574887 21:8437132-8437154 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176576330 21:8442262-8442284 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1176611221 21:8987491-8987513 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176611240 21:8987528-8987550 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1176611289 21:8987661-8987683 CAGCGCCCGCGCACCGGTCCCGG - Intergenic
1176611502 21:8988428-8988450 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1177157333 21:17512931-17512953 CGGCGCTCGCAGCCCGGCCCGGG + Exonic
1177920301 21:27143751-27143773 CCGCAGCGGCGCCTCGGCCCCGG - Intergenic
1178948391 21:36966676-36966698 CCGCCCCAGCGCCCCAGGCCCGG + Intronic
1178948414 21:36966719-36966741 CCGCGCCGCCCCCCCGGGCCAGG + Intronic
1179529595 21:42009795-42009817 CCGCGCACACCCCGCGGCCCGGG + Intronic
1179661549 21:42879181-42879203 CGGCGTCCGCTCCCCGGCTCCGG - Intronic
1179675009 21:42975040-42975062 GCGCGCCCCCGCCCCGCGCCGGG - Intronic
1179794826 21:43776592-43776614 ACCCGGCCGCGCCCCCGCCCCGG - Intergenic
1179870484 21:44241009-44241031 CCCCGTCCCCGCCCCGCCCCCGG + Intergenic
1179882788 21:44300420-44300442 CGCCGCCCGCGCCCTGCCCCGGG + Intronic
1179893704 21:44350287-44350309 TCGCGCCCTCGCCCCGGCCCCGG - Intronic
1179893705 21:44350293-44350315 CCGGGCTCGCGCCCTCGCCCCGG - Intronic
1179972882 21:44845993-44846015 CAGCCCCGGCGCTCCGGCCCAGG - Intergenic
1180005519 21:45018902-45018924 CAGGGCCCCGGCCCCGGCCCCGG + Intergenic
1180008271 21:45033224-45033246 CCGCCGCCGCGCCCTGCCCCCGG + Intergenic
1180216178 21:46324791-46324813 CCGCGCCACGCCCCCGGCCCCGG - Intronic
1180782800 22:18530101-18530123 CCGCGCCCGCGGCGCCGGCCCGG - Intronic
1181017678 22:20080483-20080505 CCGCGCCCCCGCCCCGCCCGCGG - Intronic
1181017708 22:20080567-20080589 CGGGGCCCGCCCCCCAGCCCCGG - Intronic
1181083648 22:20429434-20429456 CCGCGCCCCTGCCCCGGACGTGG - Intronic
1181126362 22:20704133-20704155 CCGCGCCCGCGGCGCCGGCCCGG - Intergenic
1181239690 22:21469439-21469461 CCGCGCCCGCGGCGCCGGCCCGG - Intergenic
1181270819 22:21657619-21657641 CCGCACCTGCGCCGCGGCCGTGG + Intronic
1181299117 22:21867165-21867187 CCGGGGCCGCGCCCGAGCCCTGG + Intronic
1181514361 22:23402664-23402686 CCGCGCCCGCGCCGGCGCCCAGG - Intergenic
1181539748 22:23566777-23566799 CCGCGTCCGCGCCCCCTCCCCGG - Intergenic
1181567914 22:23751004-23751026 CTGCGGCCCCGCCCCGGCCCAGG - Exonic
1181956359 22:26590135-26590157 CCGCGGCCCCGCCCCCGCGCGGG - Exonic
1182586323 22:31346097-31346119 CCGCTCCGGCGCCCCCGCCCCGG - Exonic
1182903904 22:33920602-33920624 CCGGCCCCGCGCCCCAGGCCGGG - Intronic
1183191071 22:36322399-36322421 GCGCGGCGGCGCCCCGGCTCTGG - Intronic
1183407858 22:37639379-37639401 CTGCGCCCGCAACCCGCCCCAGG - Intronic
1183431783 22:37770292-37770314 CCGCGCCCGCCACCACGCCCGGG - Intronic
1183622484 22:38982552-38982574 CCCCGCCCCTGCCCCAGCCCTGG + Intronic
1183702235 22:39457288-39457310 CCGGGCCCCCGCCGCCGCCCCGG + Intergenic
1183720130 22:39557766-39557788 CAGCACCCGCGCCCCCGCCCCGG + Intergenic
1183744819 22:39686222-39686244 CCGCCCCCACGCCGCCGCCCTGG + Exonic
1183780306 22:39995015-39995037 CCCGGCCCCGGCCCCGGCCCTGG - Exonic
1183780309 22:39995021-39995043 TGGCGCCCCGGCCCCGGCCCCGG - Exonic
1183856077 22:40636242-40636264 CCGCGCCCGCCCGCCCGGCCCGG + Intronic
1183856081 22:40636248-40636270 CCGCCCGCCCGGCCCGGCCCGGG + Intronic
1183956220 22:41382096-41382118 GCGCGCCCCGGCCCCGGACCGGG - Exonic
1184184803 22:42857336-42857358 CGGCGCCTGCGCCCCGGCGGTGG - Exonic
1184342216 22:43892149-43892171 CCGCCCCCACGCGCCCGCCCCGG + Intergenic
1184412070 22:44331419-44331441 CCGCTCTCGGACCCCGGCCCAGG + Intergenic
1184412178 22:44331722-44331744 CCCAGCCCCAGCCCCGGCCCCGG - Intergenic
1184439195 22:44498235-44498257 CCCCGCCCCTGCCCCGGCCCCGG - Exonic
1184439199 22:44498241-44498263 CCCCGGCCCCGCCCCTGCCCCGG - Exonic
1184523091 22:45007408-45007430 CCGCGCTCCCACCCCAGCCCGGG - Intronic
1184523134 22:45007530-45007552 CCCCGCCCGCGCCGCGCCCCCGG - Intronic
1184680788 22:46071337-46071359 CCGCCCGCGCGCGCCGTCCCGGG + Intronic
1185037930 22:48489457-48489479 CCGCCGCCGCGCCCGGGCCCCGG - Exonic
1185037954 22:48489521-48489543 CCCTGCCCGCGCCCCCGCGCCGG - Exonic
1185116272 22:48940050-48940072 CCCAGCCCCCGCCCTGGCCCTGG + Intergenic
1185278762 22:49961054-49961076 CCCCGCCCTGGCCCCGGCCCCGG - Intronic
1185285832 22:49999624-49999646 CCACCTCCGCGCCCCGCCCCCGG - Intronic
1185285852 22:49999664-49999686 CCACCTCCGCGCCCCGCCCCCGG - Intronic
1185285874 22:49999704-49999726 CACCCCCCGCGCCCCGCCCCCGG - Intronic
1185313760 22:50170295-50170317 CGCCGCCCGCGCTCCGGGCCGGG + Intergenic
1185313930 22:50170690-50170712 CCCCGCCCGCGCCCCCCGCCGGG + Intergenic
1185374141 22:50474555-50474577 CCCCGCCCGGCCCCCGGCCCCGG + Intronic
1185409457 22:50674480-50674502 CCCCGCGCCGGCCCCGGCCCCGG + Intergenic
1185409521 22:50674617-50674639 CCGCGCCGGGGCCCGGGCCGGGG - Intergenic
1185409524 22:50674618-50674640 CCCGGCCCGGGCCCCGGCGCGGG + Intergenic
1203252656 22_KI270733v1_random:125250-125272 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203252675 22_KI270733v1_random:125287-125309 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1203252723 22_KI270733v1_random:125419-125441 CAGCGCCCGCGCACCGGTCCCGG - Intergenic
1203252936 22_KI270733v1_random:126187-126209 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1203254380 22_KI270733v1_random:131320-131342 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1203260712 22_KI270733v1_random:170336-170358 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203260731 22_KI270733v1_random:170373-170395 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1203260991 22_KI270733v1_random:171268-171290 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1203262436 22_KI270733v1_random:176399-176421 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
950282425 3:11719538-11719560 TCGCGCCCGAGCCCCCGCACGGG + Intronic
950316313 3:12004657-12004679 CCGCCGCCGCCCCCCGGTCCGGG + Exonic
950400960 3:12768911-12768933 CCCCGCCCCGGCCCCGGCCCCGG - Intronic
950400965 3:12768917-12768939 CCCCCGCCCCGCCCCGGCCCCGG - Intronic
950487707 3:13282759-13282781 CCCGACCCGGGCCCCGGCCCCGG - Intergenic
950650210 3:14402538-14402560 CCCCGCCCCGGCCCCGCCCCCGG + Intergenic
954004022 3:47578323-47578345 CCCCGCCCCGGCCCCGCCCCCGG + Intronic
954110257 3:48429505-48429527 CCCCGCCCGCCGCCCGGGCCAGG + Intronic
954265984 3:49470539-49470561 CCGCGGCCGTGTCCCCGCCCCGG - Intronic
954277960 3:49554669-49554691 CCCGGCCCGGGCCCCGGCCCCGG + Exonic
954277964 3:49554675-49554697 CCGGGCCCCGGCCCCGGCCCCGG + Exonic
954277997 3:49554777-49554799 CCGGTCCCTGGCCCCGGCCCCGG + Exonic
954278000 3:49554783-49554805 CCTGGCCCCGGCCCCGGCCCCGG + Exonic
954305699 3:49724206-49724228 CCGGCCCCGCCCCACGGCCCCGG + Intergenic
954361314 3:50124286-50124308 CCCCGCCCTGGCCCCGGCCCAGG + Intergenic
954361322 3:50124298-50124320 CCCGGCCCAGGCCCCGGCCCCGG + Intergenic
954361326 3:50124304-50124326 CCAGGCCCCGGCCCCGGCCCCGG + Intergenic
954581798 3:51707004-51707026 CCCCGCCCCGCCCCCGGCCCCGG - Intergenic
954812305 3:53255795-53255817 CCCCGCCCGAGCCGCGTCCCCGG + Intronic
954812365 3:53256024-53256046 ACGCGCCCCCGCCCCGCGCCCGG - Intronic
955140103 3:56260437-56260459 TCGCCCCCGCGCCCCAGCCCTGG + Intronic
956604949 3:71064859-71064881 CCGCGCGGGCGCCCCGAGCCCGG - Intronic
956813664 3:72888450-72888472 CCGCGTCCGCGCCCCCGAGCGGG + Exonic
956979058 3:74614886-74614908 CCCAGCCCGCGCCGCCGCCCAGG - Intergenic
957193501 3:77039732-77039754 CCTCGCCCCCGCCCCTCCCCGGG + Intronic
957792463 3:84958927-84958949 CCCCGCCCCCACCCCGGCCAGGG - Intergenic
958814676 3:98901953-98901975 CCGCGGCCCCCGCCCGGCCCGGG + Intergenic
959849805 3:111072325-111072347 CCGCGCCCGGGGCGAGGCCCTGG + Intronic
960914367 3:122681193-122681215 CCCCGCCCCCGCCCCCGCCCCGG - Intronic
961081528 3:124032940-124032962 CCCCGCCCCCTCCCTGGCCCGGG + Intergenic
961182386 3:124887057-124887079 CCGCGCTCCGGCCCCAGCCCCGG - Exonic
961236887 3:125375057-125375079 CCCCGCCCTCCCCCGGGCCCGGG + Intronic
961446218 3:126983006-126983028 CCCCGCCCCCGCCCCGCCCCCGG + Intergenic
961551555 3:127672866-127672888 CCGCGGCCCCGCCCCTGCCCCGG - Intergenic
961666835 3:128497936-128497958 CCCCTCCCCTGCCCCGGCCCCGG + Intergenic
961666840 3:128497942-128497964 CCCTGCCCCGGCCCCGGCCCCGG + Intergenic
962263178 3:133927704-133927726 CCGCCCCTCCGCCGCGGCCCGGG - Intergenic
963091586 3:141487532-141487554 CCGCGCCCCCGGCCGCGCCCCGG - Intronic
963904626 3:150763244-150763266 CGGAGCCAGCGCCCCGGCGCAGG - Exonic
966181871 3:177196487-177196509 CCCGGCCGGCGCCCCCGCCCCGG + Intronic
966390915 3:179451511-179451533 CCACGTCCCCGCCCCGGCTCCGG - Exonic
966684828 3:182682730-182682752 CGCCCCCCGCGCGCCGGCCCGGG + Intergenic
966852742 3:184174831-184174853 CCGCCGCCCCGCCCCGGCCCCGG - Intronic
966866136 3:184260058-184260080 GCGCCCCCCCGCCCCGGCCCAGG - Exonic
966868583 3:184276086-184276108 CCGCTCCCGGGCCGCGGCCCCGG - Intronic
966886447 3:184380178-184380200 CCCGGCCCCGGCCCCGGCCCCGG + Exonic
966905847 3:184525552-184525574 CGGCCCCCGGCCCCCGGCCCCGG - Intronic
966911481 3:184562467-184562489 CGGCGCCCGCTCCGGGGCCCAGG + Intronic
966919374 3:184602042-184602064 CCGCCCGCGGGCCCCAGCCCCGG - Intronic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
967207817 3:187139544-187139566 CCCCGGCCCCGCCCAGGCCCGGG + Intronic
967272022 3:187740056-187740078 CAGCGCCGTCGCCCCCGCCCGGG - Intronic
967493651 3:190120427-190120449 CCGCCCCCGCCCCCCGGCGAGGG - Exonic
967924117 3:194633174-194633196 CCGCGCCCGCGCTCTGGGACTGG - Exonic
968092807 3:195909091-195909113 GCGCTCCTGCACCCCGGCCCGGG + Intronic
968372806 4:11218-11240 CCGCGCCCCCGCCCCGGCGTGGG - Intergenic
968506441 4:973352-973374 CCCGGCCCCGGCCCCGGCCCCGG + Exonic
968534333 4:1113767-1113789 CCGCGCCCGCCACCCAGGCCCGG - Intergenic
968701313 4:2059434-2059456 CCGCGCCCTTGCCCTGGGCCCGG + Intergenic
968702061 4:2061954-2061976 CCACCCCCGCGCCACGGCCTTGG + Intronic
968750603 4:2387057-2387079 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
968804591 4:2764026-2764048 CCTCCTCCGCGCCCAGGCCCTGG - Intergenic
968879774 4:3292990-3293012 CCCCGCCCTCGCCTCGACCCCGG + Intergenic
968879824 4:3293114-3293136 CCCTGCCCCCGCCCCGGCCCCGG - Intronic
968907978 4:3463325-3463347 TCGCCCCGGCGCCCCAGCCCAGG - Exonic
969021586 4:4143179-4143201 CCTAGCACGCGCCCCAGCCCCGG - Intergenic
969285704 4:6200668-6200690 CCCCGCCCCCGCCCCCGCCCCGG + Intergenic
969295656 4:6269583-6269605 CCCCGCCCCCGCCCCGCCCGCGG - Intergenic
969368662 4:6716430-6716452 CTCGGGCCGCGCCCCGGCCCCGG - Exonic
969378942 4:6782255-6782277 CTGCCGCCGCGCCCCGCCCCCGG - Intronic
969597836 4:8158898-8158920 CCGCGCCCCCGCTGCCGCCCGGG + Intergenic
969716665 4:8871307-8871329 CCTCGGCCGCCCCCCGGTCCCGG - Exonic
969732282 4:8964237-8964259 CCTAGCACGCGCCCCAGCCCCGG + Intergenic
969872990 4:10116392-10116414 CCTGGTCCGCGCCCCGGGCCAGG + Intronic
971257948 4:25030962-25030984 TCGCGCCCGCAGCCCGGCTCTGG + Intergenic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
972675690 4:41257497-41257519 CCGCGCCCGCACCCGAGCCTGGG - Intronic
973317660 4:48779418-48779440 CAGCGCCCGCACCCCTCCCCAGG + Intronic
975118479 4:70704878-70704900 CTGCTCCCCCGCCCAGGCCCGGG + Intronic
975883553 4:78939234-78939256 CCGCCGCCGCTCCCCGGCTCGGG + Exonic
976704520 4:88007429-88007451 GGGCGCCCGCGCCCGGGCTCCGG + Intergenic
976765501 4:88593214-88593236 CCTCGCCCCCGGCCCCGCCCAGG - Intronic
977600316 4:98928617-98928639 CCGCACCCGAGCCCCGGAGCTGG + Intronic
977693781 4:99946260-99946282 CCCCGCCCTGGCCCCAGCCCCGG - Intronic
978490089 4:109302873-109302895 CCCAGCCCGCGGGCCGGCCCGGG + Intergenic
979624140 4:122827096-122827118 CCGTCCCCCGGCCCCGGCCCCGG - Exonic
980405042 4:132344827-132344849 CCCAGCCCCAGCCCCGGCCCCGG - Intergenic
981508363 4:145527953-145527975 CCCCGCCCCGGCCCCGGCCCTGG + Intronic
981782947 4:148445779-148445801 CCACGCCCCCACCCCGGCCACGG + Intergenic
982235748 4:153249617-153249639 CCCTGCTCCCGCCCCGGCCCTGG + Intronic
982584857 4:157222861-157222883 CCGCGCTCGCTCCCCCGCGCAGG + Intronic
983919811 4:173333827-173333849 CCGCGCCCCCGCCCGCGCCCCGG + Intronic
984698226 4:182800140-182800162 CTGCTCGCGCGCCCAGGCCCGGG - Exonic
984803741 4:183735852-183735874 CCCCCCCCTCCCCCCGGCCCGGG + Intergenic
984888784 4:184473640-184473662 CCGAGCCCGCCCTCCCGCCCCGG + Intronic
984923410 4:184785594-184785616 CCCCCCCCCCGCCCCCGCCCAGG - Intronic
984928320 4:184825852-184825874 CGGTGCCCGGGCCCCGGCCGAGG - Intronic
984928321 4:184825858-184825880 CCGCGGCGGTGCCCGGGCCCCGG - Intronic
985006009 4:185535665-185535687 CCCCGCGCCCGCCGCGGCCCGGG - Intergenic
985068353 4:186144728-186144750 CCGGGCCCCGGCCCCGGCCCCGG - Intronic
985129072 4:186723803-186723825 CCGCGCCCTCTCCCCGCGCCCGG + Exonic
985462590 4:190121349-190121371 CCGCGCCCCCGCCCCGGCGTGGG + Intergenic
985611648 5:892721-892743 CCGCCACCGCCCCCTGGCCCTGG + Exonic
985727272 5:1523150-1523172 CCGCCCGCGCGCCCTGTCCCGGG + Intronic
985784562 5:1887027-1887049 CCCCGCTCCCGCCCCCGCCCCGG - Exonic
986132225 5:4942345-4942367 CGGCGCCCGCGCGGCTGCCCAGG + Intergenic
986733281 5:10650138-10650160 CCCCGCCCCGGCCCCAGCCCCGG - Exonic
988437579 5:31194033-31194055 CCGCGCGCCCGCCCCGACCCGGG - Intronic
989146963 5:38258638-38258660 CCACCTCCTCGCCCCGGCCCGGG + Exonic
990553698 5:56909572-56909594 CCTCGGGCCCGCCCCGGCCCGGG - Exonic
990557649 5:56951905-56951927 CCGCGCCCGCTCCCGCCCCCCGG + Intronic
991245669 5:64506337-64506359 CCGCGCCAGCGCCCAGCTCCCGG + Exonic
991584406 5:68187601-68187623 CCCCGCCCGCTCCCAAGCCCGGG - Intergenic
992226217 5:74621670-74621692 CCCCCCCCGCCCCCCGCCCCCGG + Intergenic
992597315 5:78360059-78360081 CAGCGGCCGCGCCCCCGCCCCGG + Intergenic
994107363 5:95961900-95961922 CCGGCCCCGCGCCCCGCCCCGGG + Exonic
994197272 5:96935223-96935245 CGGCGCCCGCGACCCGGGCCGGG + Intronic
994367051 5:98928582-98928604 CCTCCCCCGCGCCCAGGCCCGGG + Exonic
995402427 5:111757715-111757737 CTGCGCCCCGGCCCCGCCCCGGG + Intronic
995623897 5:114056199-114056221 GCTCGCCCGCGCCCGCGCCCCGG + Intergenic
995787119 5:115841981-115842003 TCGCGCGCCCGCCCCCGCCCTGG + Exonic
996329333 5:122312003-122312025 CCGCGCCCCCGTCCCCGGCCGGG + Intronic
997521377 5:134526331-134526353 CCGCGCCCCCTCGCCGGCCCGGG - Intronic
997521606 5:134527153-134527175 CCCCGGCCCCGCCCCGCCCCCGG + Intronic
997654429 5:135544763-135544785 GCGCGCACGCCCCGCGGCCCGGG + Intergenic
997704108 5:135930628-135930650 CCCCTCCCGCGGCCCGGGCCCGG + Intronic
998101536 5:139439155-139439177 CCCCGCCCGTGCCCCGCCCAGGG - Intronic
998119153 5:139561744-139561766 CCCCGCCCCCGTCCCCGCCCCGG + Exonic
998130285 5:139648331-139648353 CCGCCGCCGCGCGCCCGCCCGGG - Exonic
998166717 5:139848470-139848492 CCGGGCCCGGGCCCGGGCCCGGG + Exonic
998166718 5:139848475-139848497 CCGGACCCGGGCCCGGGCCCGGG - Exonic
998166721 5:139848476-139848498 CCGGGCCCGGGCCCGGGTCCGGG + Exonic
1000907358 5:166978850-166978872 CCGAGAGCGCGCACCGGCCCAGG - Intergenic
1001666244 5:173435764-173435786 CCGCACCCGCGCCCTCACCCTGG + Intergenic
1002058101 5:176610152-176610174 CCCGCCCCGCGCCCCGCCCCGGG + Intergenic
1002071322 5:176680355-176680377 CCGCGCCCGGGAGCCGGCCCAGG - Intergenic
1002169528 5:177367364-177367386 CAGCGCCCCCACCCCAGCCCCGG + Intronic
1002170334 5:177371073-177371095 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1002170338 5:177371079-177371101 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1002170342 5:177371085-177371107 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1002170346 5:177371091-177371113 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1002170350 5:177371097-177371119 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1002170354 5:177371103-177371125 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1002524227 5:179806638-179806660 CGACCCCTGCGCCCCGGCCCCGG - Intronic
1002622097 5:180494927-180494949 CCGCGATCGCGCCCCGCCCCGGG + Intronic
1002632783 5:180591830-180591852 CGCCGCCCCCGCCCCTGCCCTGG - Intergenic
1002771127 6:291946-291968 CGGAGCCCGCTCCCCGGCCGGGG - Intronic
1003116408 6:3286640-3286662 CCCTGCCCCTGCCCCGGCCCGGG - Intronic
1003291278 6:4780408-4780430 CCCCGCCCCCGCCCCCGCCCCGG + Intronic
1003427549 6:6007669-6007691 GCGCGCACACGCCCAGGCCCCGG + Intergenic
1003983900 6:11416946-11416968 CTGCGCCCGTGACCCGGCCAAGG - Intergenic
1004562091 6:16760917-16760939 CCCCGCCCGCGCCCCCCGCCCGG + Intronic
1004627926 6:17393938-17393960 CCGCGCCCGCGCCCCGCGCCCGG - Intronic
1004660643 6:17706462-17706484 CCTCCCCCGCCGCCCGGCCCCGG + Exonic
1004690229 6:17987296-17987318 CCGCCCCGGCCCCCCGGCCCCGG + Intronic
1004690328 6:17987653-17987675 CCGCGCGCCCGCCCCTCCCCGGG - Intergenic
1006300730 6:33192500-33192522 CCTCGCCCCCGCCCCCGGCCCGG + Intergenic
1006472786 6:34237693-34237715 CCGAGCCCGAGCCCGGGCCCGGG + Intronic
1006472956 6:34238255-34238277 CCCCCCGCGCGCCCTGGCCCCGG + Intronic
1006606161 6:35259428-35259450 CCGCGCCCAGGCCCTGACCCGGG + Intronic
1006630758 6:35428003-35428025 CCGCGTCCCTGCCCCGACCCGGG + Exonic
1006634414 6:35452133-35452155 CCCCGCCCCCGCCCCGCTCCAGG + Intergenic
1006814327 6:36840055-36840077 CCCCGCCCGCGGCCCCGCCCCGG - Intergenic
1006891491 6:37433149-37433171 CCCCGGCCGGGTCCCGGCCCCGG - Intergenic
1006932761 6:37697608-37697630 CCGCGCCGCAGCCCCGGCCTGGG - Exonic
1006932765 6:37697614-37697636 CGGCGCCCGCGCCGCAGCCCCGG - Exonic
1007390259 6:41546545-41546567 CCCCGCCCCCGGCCCAGCCCTGG - Exonic
1007401532 6:41605346-41605368 CCGCGCCCGGCCCCGGGGCCAGG - Intergenic
1007451272 6:41941602-41941624 CCCGGCACGCGCCCCGGGCCGGG - Exonic
1007479020 6:42137804-42137826 CCCCGCCCCCGCCCCTGCCTCGG - Intronic
1007584202 6:42978866-42978888 CCGCGCCCGCACCCAGGCCCCGG + Exonic
1007591156 6:43021677-43021699 CCCGGCCCCGGCCCCGGCCCCGG - Exonic
1007591159 6:43021683-43021705 TCGGGCCCCGGCCCCGGCCCCGG - Exonic
1007625380 6:43243618-43243640 CCCCCGCCCCGCCCCGGCCCCGG + Intergenic
1007701781 6:43770120-43770142 CCCCGCCCCCGGCCCGCCCCGGG - Intergenic
1007783199 6:44265631-44265653 CCCCGCCCCCTCCCCGCCCCCGG + Exonic
1010209889 6:73354338-73354360 CCCCGCCCCCGGCCCGGGCCAGG + Intergenic
1011277438 6:85643758-85643780 GCGCGCCCGGCCCCCGCCCCCGG + Intronic
1013226054 6:108119918-108119940 CTGCGCGCACGCCCTGGCCCTGG + Intronic
1013372669 6:109483548-109483570 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1013372673 6:109483554-109483576 CCCTGCCCCGGCCCCGGCCCCGG - Intergenic
1014009774 6:116462246-116462268 CCGCGCTCGCGCCCCTCACCTGG + Exonic
1014798283 6:125749533-125749555 CCGCCCCCGCGCACCGGCCCAGG - Intronic
1015149254 6:130019941-130019963 CCGCGCCCGCGCCCGCACCCGGG - Intronic
1015845810 6:137519730-137519752 CCGCCCCCCCGCCCCTGCCATGG + Intergenic
1015965698 6:138693438-138693460 CCTCGCCCGCCCCCCGGGCCGGG + Intergenic
1016010655 6:139135150-139135172 CCGCGCGGGCGCCGCGGGCCCGG - Exonic
1016340922 6:143060817-143060839 CCGCGCCCGCGCCCGCGCCCGGG + Intronic
1016596991 6:145814492-145814514 CAGCGCCAGCGCCTCGGTCCCGG + Intronic
1017163779 6:151390283-151390305 CCGCGCCCCCGGCCCCGCCCCGG - Intronic
1017662420 6:156687442-156687464 CGGCCCCCACGCCCCGGCCGCGG + Intergenic
1017725822 6:157275193-157275215 CGCCGCCCGCGCCCGGCCCCGGG - Intergenic
1017738119 6:157381634-157381656 CCCCGGCCGCGCCTCGGCTCTGG - Exonic
1017842289 6:158232036-158232058 CCGCCCTCCCTCCCCGGCCCAGG - Intergenic
1017971470 6:159315739-159315761 CAGCGCCCGCGCCCTGTCCTAGG + Intergenic
1018091132 6:160347908-160347930 GCGCGCGCGCGCCCCGGGTCCGG - Intergenic
1018150289 6:160931187-160931209 GCCCACCCGCGCCCCCGCCCCGG - Intergenic
1018331060 6:162727777-162727799 CCGCCCCCGCGCCCGGCCCTAGG + Intronic
1018400303 6:163414553-163414575 CCCCGCCCGCCGCCCGCCCCCGG + Intronic
1018628730 6:165804790-165804812 CTCCGCCCGCGGCCCGGCCCCGG - Intronic
1018876762 6:167827544-167827566 CCGCGAGCGCGGCGCGGCCCCGG + Intronic
1018892065 6:167989655-167989677 CTCCGCCTGCGTCCCGGCCCAGG - Intergenic
1019343087 7:517627-517649 CGGAGCCCTCGCCCCGGCCCTGG + Intronic
1019343627 7:519643-519665 CCGCGGGCGCTGCCCGGCCCCGG - Intronic
1019355863 7:578575-578597 CCGCGTCCGCATCCCGGCCATGG - Intronic
1019473389 7:1232947-1232969 CCGCTGGCCCGCCCCGGCCCCGG + Exonic
1019473400 7:1232973-1232995 GCGCCCCCGCGCCCCGCCACCGG + Exonic
1019536169 7:1530923-1530945 CCCCGTCCCCGCCGCGGCCCGGG - Intronic
1019562653 7:1666149-1666171 CGGGGCCCGCACCCCGGCCCAGG + Intergenic
1019562918 7:1666958-1666980 CCGCGCCAGCTTCCCGGACCGGG - Intergenic
1019719299 7:2558910-2558932 CAGCCCCCGCGCTCCGCCCCGGG + Intergenic
1020274331 7:6615600-6615622 CCGCGCCCCCGCCCCCGGCCCGG + Exonic
1020445344 7:8262060-8262082 GCGCGCCCCCGCCCCGACCCCGG + Intronic
1020560550 7:9726164-9726186 CCGCGCTCGGACCCTGGCCCTGG + Intergenic
1021450342 7:20778285-20778307 GCGAGCCCTGGCCCCGGCCCGGG - Intergenic
1021692893 7:23247719-23247741 CGTGGGCCGCGCCCCGGCCCAGG + Intronic
1021958804 7:25852590-25852612 CCGCGCCCCCGCCCCGGCTCGGG + Intergenic
1021969230 7:25950941-25950963 CCGCCCGTGCACCCCGGCCCGGG - Intergenic
1022207580 7:28179721-28179743 CCGCGTCCCCGGCCCCGCCCGGG + Intronic
1023637587 7:42228070-42228092 CCGCGCCGCCGCCGCGGCCTGGG - Intronic
1023918387 7:44607377-44607399 CCGCGCCCTCGCCCTGACCTGGG + Intronic
1024043776 7:45574315-45574337 GCCCGCCCGCGCCCCGACCGTGG - Intronic
1024262260 7:47581702-47581724 CCGCGCCCCAGCCCCTGTCCTGG + Intronic
1024262416 7:47582203-47582225 CCGCGCCCGCGCCCCGAGCCTGG + Intronic
1025032831 7:55571879-55571901 CCGCGCCTGCGCCGCGCCCGAGG + Intronic
1025777304 7:64570405-64570427 CTGCGCCCGGGGCCCGGCTCCGG - Intergenic
1025940855 7:66075628-66075650 CCCCGCCCGCTTCCCCGCCCCGG + Intergenic
1026025593 7:66741251-66741273 CCGCGCCCCTGCCGCGGCCGGGG - Intronic
1026806928 7:73434562-73434584 TGCCGCCCGCGCCCGGGCCCAGG - Exonic
1026840383 7:73667629-73667651 CTGCGCCCCAGCACCGGCCCTGG - Intergenic
1027059410 7:75073661-75073683 CAGTGCCCTCGCCCCAGCCCCGG + Exonic
1027232625 7:76281628-76281650 CGGCGTCCGCGCCCCGCCGCAGG + Exonic
1029270575 7:99374762-99374784 CACCTCCCGCGCCCCGGCCGCGG - Exonic
1029456180 7:100673707-100673729 CCGCCGCCGCGCCCAGGACCCGG - Exonic
1029539338 7:101173552-101173574 CCCCGCCTGCGCCCCTGCCAGGG + Intronic
1029549987 7:101232529-101232551 CCGCGCCCCCGCTCTGACCCCGG - Intronic
1029996425 7:105012717-105012739 CCCCTCCCCCGCCCCGGCCTGGG + Intergenic
1030033475 7:105388993-105389015 CCGCCCCCACCCGCCGGCCCCGG + Intronic
1030093348 7:105876746-105876768 CCGCGCCCGCCCGCCCGCCGGGG + Intergenic
1031406752 7:121396024-121396046 CCGGGCCCGGGGCCCGCCCCCGG + Intronic
1031406865 7:121396389-121396411 CCGCGCCCGCCCCCTGGCGGTGG + Intergenic
1031886602 7:127251699-127251721 CCGCGCCCACGCCCCGCGCGGGG + Intronic
1031919057 7:127588328-127588350 CCCCGTCCGGGCCCCGCCCCCGG - Exonic
1031919099 7:127588469-127588491 CGGTGCCCGCGCCCCTCCCCGGG + Exonic
1031919130 7:127588588-127588610 CGGGGCCGGCGCCCCGGTCCGGG - Intronic
1032014536 7:128369599-128369621 CCCCGCCCCCGCTCCGGCCTCGG - Intergenic
1032090805 7:128910604-128910626 CCGCGCCCGCGGCCAGCGCCAGG + Exonic
1032125392 7:129189226-129189248 TCGAGGCCGCCCCCCGGCCCGGG - Exonic
1032130720 7:129225251-129225273 CGGCCCCCGGTCCCCGGCCCGGG + Exonic
1032193972 7:129779514-129779536 TCCCGCCCCCGCCCCCGCCCGGG + Intergenic
1032194428 7:129780958-129780980 CCGCGTCCGCGCCCCAGCCCCGG - Intergenic
1032344295 7:131105744-131105766 CCGCGCGGGTGCCCCGGCGCTGG - Intergenic
1033220474 7:139523887-139523909 CCGCGCCCGCGCTCCTGCACCGG - Exonic
1033339339 7:140479533-140479555 GCGCGCCCGCGGCCCGCCCACGG + Exonic
1033365950 7:140672912-140672934 CCCCGCCTGCGCCCGCGCCCTGG + Intronic
1033595271 7:142854758-142854780 CCGAGCCCGAGCCCGAGCCCAGG + Intergenic
1033595333 7:142854929-142854951 CGGCGCCCGCTCCTCCGCCCCGG - Intergenic
1033732826 7:144195634-144195656 CCCCACCCGCGGCCCGCCCCTGG + Exonic
1033743676 7:144294214-144294236 CCCCACCCGCGACCCGCCCCTGG + Intergenic
1033750225 7:144355383-144355405 CCCCACCCGCGGCCCGCCCCTGG - Exonic
1034342714 7:150368684-150368706 GGGCGCCCGCGCCCCGGCCCCGG + Intronic
1034392789 7:150799988-150800010 CCGCTCCCTGGCCCCGTCCCAGG + Intronic
1034440502 7:151083392-151083414 CCGCGCCCACCCCGCCGCCCAGG - Intronic
1034441049 7:151086341-151086363 CCCCTCCTGCGCGCCGGCCCGGG - Intronic
1034483614 7:151341991-151342013 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1034522483 7:151631901-151631923 CGGCGCCCGCATCCCCGCCCCGG + Intronic
1034535117 7:151721386-151721408 CCCGGCCCTGGCCCCGGCCCTGG - Intronic
1034911657 7:155002968-155002990 CCCCGCCCACCCCCCGCCCCCGG + Exonic
1035021323 7:155802867-155802889 CCCCTCCCGCGCCCCTCCCCCGG + Exonic
1035153206 7:156892622-156892644 CCGCCCCCGCCCCGCGGCCTCGG - Intronic
1035168184 7:157003767-157003789 CAGCAGCCGCGCCCCGGCCTTGG + Intronic
1035227817 7:157443288-157443310 CCGCCCCCCCACCCCGACCCGGG + Intergenic
1035404256 7:158587833-158587855 CCCCGCCCCGGCCCCGCCCCCGG + Intergenic
1035476123 7:159145100-159145122 CCGCGCCCTCTCCTCGCCCCTGG + Intergenic
1035622650 8:1045636-1045658 CCGCGCCCCCACCCAGGTCCTGG + Intergenic
1035747548 8:1973488-1973510 CCGAGCCCGCGCCCACGCGCGGG - Intergenic
1036195271 8:6708499-6708521 CCGCGCCGCCGCCCGGGGCCGGG - Exonic
1036390296 8:8318864-8318886 GCCCGCCCCCGCCCCCGCCCCGG - Exonic
1036454252 8:8893565-8893587 CCGCGCTCCCGCCCGAGCCCGGG - Exonic
1036789439 8:11708474-11708496 CAGAGCCCGCGCCTCCGCCCTGG - Exonic
1036910381 8:12754072-12754094 CCGCGCGGGCGCCCGGCCCCGGG - Intronic
1037305152 8:17497032-17497054 CCGCGCCCCGCCCCCGCCCCGGG + Intergenic
1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG + Intronic
1037450800 8:19014009-19014031 CCGCAGCCGCGCGCCCGCCCTGG + Intronic
1037803907 8:22049123-22049145 CCTCGCCTGCGCCTCGGGCCTGG - Intronic
1037826794 8:22164841-22164863 CCGAGCCCCCGCCCCGCCGCGGG - Exonic
1037907514 8:22724227-22724249 CCGCTCCTGCTCCCTGGCCCTGG + Intronic
1038425680 8:27462442-27462464 CCGCTCCCCCGCCCCTGCCATGG - Intronic
1038542496 8:28401850-28401872 CGGCGCCGGAGCCGCGGCCCCGG - Intronic
1038575567 8:28701341-28701363 CCGGCCCCGCGCCCCTGACCCGG + Exonic
1039903152 8:41767263-41767285 CAGAGCCCCGGCCCCGGCCCCGG + Intronic
1039903166 8:41767289-41767311 CGATCCCCGCGCCCCGGCCCCGG + Intronic
1040471466 8:47738337-47738359 CGGGGCCCCCTCCCCGGCCCTGG + Exonic
1041108000 8:54459657-54459679 CCGCGCCCGCCGCCCGCCCCGGG - Exonic
1041355319 8:56993695-56993717 TGGCGCCCGCTCCCCGGCCCCGG + Exonic
1041502412 8:58553333-58553355 CCGCGCCCGGGACCTGGCACCGG - Intronic
1041690407 8:60680434-60680456 CAGCGCCCCCACCCCCGCCCGGG - Intronic
1041919854 8:63169042-63169064 CAGGGCGCACGCCCCGGCCCGGG - Intronic
1045111055 8:98940096-98940118 CTGTGCCCGCGCGCCGCCCCGGG + Intronic
1045111893 8:98944444-98944466 CCCCGCCCGCGTCCCTCCCCAGG - Exonic
1045304816 8:100950637-100950659 CCGCGCCCCCGCCCAAGCCGTGG + Intronic
1045305418 8:100952701-100952723 CCGCGCCCTGCCCCCGCCCCGGG - Intronic
1045432050 8:102123811-102123833 CCGGCCCCCGGCCCCGGCCCCGG + Intronic
1045488597 8:102654079-102654101 CCTCGCCCACGCCCCCGCCCCGG - Intronic
1045509973 8:102806569-102806591 CCGCGCTCTCTCCCCGCCCCTGG + Intergenic
1047124784 8:121948352-121948374 CCCCGCCCCCGCCCCCGCCATGG + Intergenic
1047454703 8:124998449-124998471 TCGCGCCTGAGCCCCGCCCCCGG + Intergenic
1047615277 8:126557993-126558015 CCGCGCCCGCCCTCAGGCTCGGG + Intronic
1047951560 8:129939698-129939720 CCGCTCCCCCGCTCCGGACCCGG - Exonic
1047998611 8:130358714-130358736 CCCCGCCCGCGCCCCGCCCCCGG + Intronic
1048484163 8:134831987-134832009 CCTCGCCCGACCCCCGACCCCGG - Intergenic
1049109758 8:140635527-140635549 GCGCGGCCGCCCCTCGGCCCCGG - Exonic
1049145885 8:141000953-141000975 CCCCTCCCGCGCCCCCGGCCCGG - Intronic
1049194681 8:141308606-141308628 CCCGGCCCCGGCCCCGGCCCCGG + Intergenic
1049237259 8:141518562-141518584 CTGCGCCCGCGCGCGGGGCCCGG + Exonic
1049237263 8:141518568-141518590 CCGCGCGCGGGGCCCGGGCCCGG + Exonic
1049410392 8:142471401-142471423 CACCGCCCGGGCCCCGACCCCGG - Intronic
1049419571 8:142510823-142510845 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1049419573 8:142510829-142510851 GCGGCTCCGCGCCCCGGCCCCGG - Intronic
1049717693 8:144100682-144100704 CCTGGCCCCGGCCCCGGCCCCGG + Intronic
1049756633 8:144313791-144313813 CCGCCTCCCCGCCCCGCCCCCGG + Intronic
1049775302 8:144401182-144401204 CCGCGCTCCCGCCCCCGCCCAGG - Intronic
1049782202 8:144434202-144434224 CAGCGCCTGCTCCCTGGCCCTGG - Exonic
1049784510 8:144444124-144444146 CCCGGCCCGGGCCCGGGCCCCGG + Intronic
1049791642 8:144475124-144475146 CCGCCCCCGGGCTCCGACCCTGG + Intronic
1049803528 8:144528866-144528888 CCGCGACCGCGCCAAGGCCAGGG + Exonic
1049803565 8:144529019-144529041 CCGCCTCCGCGACCCGGGCCCGG + Exonic
1051170453 9:14315003-14315025 CCGCGCCCCAGCCCCGGCCTGGG - Intronic
1052362242 9:27573514-27573536 CCCCGACCACGCCCCGGCCCCGG + Intronic
1052362246 9:27573520-27573542 CCACGCCCCGGCCCCGGCCCCGG + Intronic
1052982310 9:34458284-34458306 CCGCGGCCGCGCCCGGCCCCTGG - Exonic
1053129236 9:35605689-35605711 CCGCCCGTGCCCCCCGGCCCCGG - Exonic
1053786335 9:41655232-41655254 CCGGCCCCGGACCCCGGCCCAGG - Intergenic
1053786344 9:41655245-41655267 CCGCCCCCGCCTCCCGGCCCCGG - Intergenic
1053789972 9:41679928-41679950 CCGCGCCCTCGCCCGGGACTCGG + Intergenic
1054155166 9:61634829-61634851 CCGCGCCCTCGCCCAGGACTCGG - Intergenic
1054175049 9:61869176-61869198 CCGGCCCCGGCCCCCGGCCCCGG - Intergenic
1054178311 9:61891617-61891639 CCGCGCCCTCGCCCGGGACTCGG + Intergenic
1054659218 9:67689207-67689229 CCGCGCCCTCGCCCGGGACTCGG - Intergenic
1054662488 9:67711617-67711639 CCGGCCCCGGCCCCCGGCCCCGG + Intergenic
1054781977 9:69174146-69174168 CCGCGCTGGCCGCCCGGCCCGGG - Intronic
1054835665 9:69672604-69672626 CAGCGCCCCTGCCCCGGCGCCGG + Intergenic
1055044536 9:71910915-71910937 CCGCTCCAGCGCCCCGCACCGGG - Exonic
1055611578 9:78030930-78030952 ACGCGCCCGCGCGCCCGCGCGGG + Intronic
1055757319 9:79570979-79571001 CCCCGCCCACCCCGCGGCCCCGG + Intergenic
1055785200 9:79863724-79863746 CCTGGCCCCGGCCCCGGCCCCGG + Intergenic
1055785203 9:79863730-79863752 CCCGGCCCCGGCCCCGGCCCCGG + Intergenic
1056643317 9:88388730-88388752 GCGCGCCCGCCCCGAGGCCCAGG - Intronic
1057072867 9:92115268-92115290 CCGCGACCACACCCGGGCCCGGG - Intronic
1057225293 9:93289665-93289687 CCGGGCCTGCGCCCGGGCTCCGG - Intronic
1057245613 9:93451897-93451919 CCGCGCCCCCGCCGCCGCCATGG + Exonic
1057432229 9:95004938-95004960 GCCCGCCCGCGCCGCCGCCCAGG + Intronic
1057488718 9:95506368-95506390 CGGCGCCCGCGCCCCCGGCCCGG - Intronic
1057619106 9:96619421-96619443 GCGCGCCCGCGCGCCCGCCGAGG + Exonic
1057773040 9:97984057-97984079 CCCCACCCGCGCCCCTTCCCCGG - Intronic
1057869686 9:98708606-98708628 CCGCGCCCAGCCCCAGGCCCCGG + Exonic
1058967279 9:110049376-110049398 CCGGGCCCCGGCCCCGGTCCCGG + Intronic
1058991237 9:110256608-110256630 CCCCGGCCACGCCCCGCCCCTGG + Exonic
1059061252 9:111037768-111037790 CCGCGCACCCACCCCGACCCAGG + Intronic
1059176768 9:112175256-112175278 GCGCGCCCGCGCCTCCTCCCGGG + Exonic
1059305351 9:113349601-113349623 CCGGACCCGGACCCCGGCCCCGG - Exonic
1059769796 9:117414665-117414687 CGGCGCCCGCGCCGGGGCCGGGG - Exonic
1060176311 9:121499708-121499730 CCGCGCCCAGCTCCCGGCCCCGG + Intergenic
1060478128 9:124000176-124000198 CGCCCCCCGCCCCCCGGCCCTGG + Intergenic
1060478135 9:124000182-124000204 CCGCCCCCCGGCCCTGGCCCGGG + Intergenic
1060666234 9:125433623-125433645 CCACGCCGGCCCCCCTGCCCTGG - Intergenic
1060770111 9:126326615-126326637 CCGAGCCCGCGCCGCCGCCCCGG - Intergenic
1061061062 9:128250766-128250788 CCGTGCCCCCAGCCCGGCCCGGG + Exonic
1061237778 9:129352309-129352331 CCGCCCCCTCGCCCTGGCCGCGG + Intergenic
1061264499 9:129497351-129497373 CCCCGCCCCCGCCCGGGCCTAGG - Intergenic
1061275897 9:129569216-129569238 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1061275900 9:129569222-129569244 CCTGGCCCCGGCCCCGGCCCCGG - Intergenic
1061275924 9:129569265-129569287 CCGCGCCCCCGCCCCCTCCTCGG - Intergenic
1061293579 9:129665798-129665820 CCGCGCCCGCGACCCTTCCTGGG + Exonic
1061293665 9:129666043-129666065 CCGCGCCTCGGCCCTGGCCCCGG - Exonic
1061293670 9:129666049-129666071 GCCCTCCCGCGCCTCGGCCCTGG - Exonic
1061293710 9:129666162-129666184 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1061293713 9:129666168-129666190 CCGCGCCCCGGCCCCGGCCCCGG - Intronic
1061293717 9:129666174-129666196 CGGACCCCGCGCCCCGGCCCCGG - Intronic
1061449489 9:130660680-130660702 CCTCCCCCGCACCCAGGCCCGGG + Intergenic
1061559650 9:131394275-131394297 CCACGCCCCGGCCCCGGCCCCGG - Intronic
1061559655 9:131394281-131394303 CCGCCCCCACGCCCCGGCCCCGG - Intronic
1061608943 9:131733353-131733375 CCCCCCCCCCGCCCCCGCCCCGG - Intronic
1061671788 9:132192923-132192945 TCCGGCCCCCGCCCCGGCCCGGG - Intronic
1061860614 9:133466729-133466751 CCCCGCCCCCACCCCAGCCCAGG + Intronic
1061975964 9:134068159-134068181 CCGGCGCCGCGCCCCGCCCCGGG + Intronic
1061975998 9:134068219-134068241 CCCCGCGCGCCCCCCGGGCCAGG - Intronic
1062230632 9:135479885-135479907 CCCTCCCCGCGCCCCGGCCGAGG + Exonic
1062323233 9:136000726-136000748 CCCCGCCCCCCCCCCCGCCCCGG - Intergenic
1062389342 9:136327774-136327796 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1062389346 9:136327780-136327802 CCCAGCCCCGGCCCCGGCCCCGG - Intronic
1062560764 9:137140913-137140935 CCACCCCCGTGCCCCAGCCCAGG + Intronic
1062571763 9:137189013-137189035 CCGCCGCCGCGCTCCTGCCCTGG + Intronic
1062574721 9:137200783-137200805 CCGCGGCCACGCCCCCTCCCGGG + Exonic
1062584018 9:137240924-137240946 CCCCGTCCGCGCGCCGGCCGCGG + Intergenic
1062621256 9:137423459-137423481 CCGCCGCCTGGCCCCGGCCCCGG + Exonic
1062628640 9:137454042-137454064 CCACGCCCCCAGCCCGGCCCAGG - Intronic
1062628657 9:137454080-137454102 CCACGCCCCCAGCCCGGCCCAGG - Intronic
1062628674 9:137454118-137454140 CCACGCCCCCAGCCCGGCCCAGG - Intronic
1062628691 9:137454156-137454178 CCACGCCCCCAGCCCGGCCCAGG - Intronic
1062628708 9:137454194-137454216 CCACGCCCCCAGCCCGGCCCAGG - Intronic
1203469059 Un_GL000220v1:108401-108423 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203469078 Un_GL000220v1:108438-108460 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1203469338 Un_GL000220v1:109334-109356 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1203470781 Un_GL000220v1:114464-114486 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1203476880 Un_GL000220v1:152373-152395 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203476899 Un_GL000220v1:152410-152432 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1203477159 Un_GL000220v1:153306-153328 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1203478602 Un_GL000220v1:158436-158458 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1185504044 X:619192-619214 CCTCCCCCGCACTCCGGCCCGGG + Intergenic
1186466241 X:9786355-9786377 CCCGGCCCCGGCCCCGGCCCCGG + Intergenic
1186496423 X:10015483-10015505 CCGCGGCCGCCCCCGCGCCCCGG + Intergenic
1186496505 X:10015720-10015742 CCGCGCCGCCGCCGCGGGCCCGG + Exonic
1186669841 X:11757868-11757890 GAGCGCCCGCTCTCCGGCCCGGG - Intergenic
1186670018 X:11758408-11758430 CCGCCCCCGCCCCCGGTCCCGGG - Intronic
1187384049 X:18831409-18831431 CCGCGCCCGGCCCCCATCCCGGG - Intergenic
1187419390 X:19121991-19122013 GCGCGAACGCGCCCGGGCCCCGG - Intronic
1189308600 X:40005390-40005412 GCTCGCCCGCGCCCCGGGCTCGG - Intergenic
1189325688 X:40109501-40109523 CCGCTCCTCGGCCCCGGCCCCGG + Intronic
1190385627 X:49879949-49879971 CCCGGCCCCCGCCCCGGCCCCGG + Exonic
1190385631 X:49879955-49879977 CCCCGCCCCGGCCCCGGCCCCGG + Exonic
1190783959 X:53625803-53625825 CCCGGCCCTGGCCCCGGCCCTGG - Intronic
1190783975 X:53625833-53625855 CCTGGCCCCGGCCCCGGCCCCGG - Intronic
1190783979 X:53625839-53625861 CCCGGCCCTGGCCCCGGCCCCGG - Intronic
1190783987 X:53625851-53625873 CCCGGCCCCGGCCCCGGCCCTGG - Intronic
1190783991 X:53625857-53625879 CCCGGCCCCGGCCCCGGCCCCGG - Intronic
1190783994 X:53625863-53625885 CCTGGCCCCGGCCCCGGCCCCGG - Intronic
1190984413 X:55488505-55488527 CCCCACCCGCACCGCGGCCCAGG - Exonic
1192152005 X:68718366-68718388 CCCGGCCCCAGCCCCGGCCCCGG + Exonic
1192180313 X:68912110-68912132 CCGGGCCCCAGCCCTGGCCCAGG + Intergenic
1192452866 X:71254319-71254341 CGGCGCCTGAGCCCCCGCCCGGG + Intronic
1192533720 X:71911065-71911087 CTGCGCCCGCGCCCGCGGCCGGG + Intergenic
1195138150 X:101931687-101931709 CCGCCCCCGCACCCCGGGACGGG + Intronic
1195716870 X:107826438-107826460 GCGCCCCCTCGCCGCGGCCCTGG + Intronic
1195954899 X:110318230-110318252 CCCCGCGCGCGCCCCCGCCTCGG + Exonic
1196636925 X:118012670-118012692 CCCTGCCCCCGCCCCCGCCCAGG - Intronic
1196804737 X:119574383-119574405 CTGCGCTCGCGGCCCCGCCCCGG + Intergenic
1197734893 X:129843406-129843428 CCGCGCCCGCGGCTCGGCCCCGG - Intronic
1197766098 X:130060369-130060391 CCGCGCTCTGGCCCCGCCCCCGG - Intergenic
1198518550 X:137430460-137430482 CCCCGCCCCCTCCCCCGCCCCGG - Intergenic
1198534500 X:137573750-137573772 CGCCGCCTCCGCCCCGGCCCCGG - Intronic
1199760121 X:150898711-150898733 GCGCGCGCGCGGCGCGGCCCCGG + Intronic
1199772643 X:150984155-150984177 CGGCGCCCGCGGCCCGGGGCGGG + Intronic
1200128466 X:153829205-153829227 CCCCGCCCCCGCCCCCGCCCCGG + Intronic
1200128763 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG + Intronic
1200146356 X:153928225-153928247 CGTCGGCCGCGCCCCGGCACCGG - Intronic
1200173799 X:154097792-154097814 GCGCGCCCGCGCCCCGCCCTCGG + Intergenic
1200177173 X:154125440-154125462 CCGCGCCCCAGCCTCAGCCCCGG + Intergenic
1200209647 X:154341590-154341612 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1200209651 X:154341596-154341618 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1200209655 X:154341602-154341624 CCCGGCCCCGGCCCCGGCCCCGG - Intergenic
1200209660 X:154341608-154341630 TCCCGCCCCGGCCCCGGCCCCGG - Intergenic
1200221192 X:154390484-154390506 TCCCGCCCCGGCCCCGGCCCCGG + Intronic
1200221197 X:154390490-154390512 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1200221201 X:154390496-154390518 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1200221205 X:154390502-154390524 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1200221209 X:154390508-154390530 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1200221213 X:154390514-154390536 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1200221217 X:154390520-154390542 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1200221221 X:154390526-154390548 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1200221225 X:154390532-154390554 CCCGGCCCCGGCCCCGGCCCCGG + Intronic
1200221229 X:154390538-154390560 CCCGGCCCCGGCCCCGGCCCCGG + Intronic