ID: 1037454627

View in Genome Browser
Species Human (GRCh38)
Location 8:19051189-19051211
Sequence GATTGGGACCAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 464}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037454627 Original CRISPR GATTGGGACCAGAGGGAGGA GGG (reversed) Intronic
900252391 1:1677963-1677985 GATTGAGACCTGGGGGAGGTGGG - Intronic
900365317 1:2309753-2309775 GATCGGACCCACAGGGAGGAGGG - Exonic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900474431 1:2869557-2869579 GATTTAGGCCAGAGGGAGGCCGG - Intergenic
900568609 1:3347472-3347494 GCCTGGGACCAGACGCAGGAGGG - Intronic
900641416 1:3689632-3689654 GGTGGGGACGACAGGGAGGAAGG + Intronic
900648451 1:3719453-3719475 GGTTGGGGACAGAAGGAGGAGGG - Intronic
900888510 1:5432335-5432357 GAGTGGGTCCAGAGCAAGGAAGG - Intergenic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903830066 1:26169390-26169412 GGTTGGGGTCAGAGAGAGGATGG + Intergenic
905168302 1:36096425-36096447 AATTGGAACCAGAGGGTGGAAGG + Exonic
905244222 1:36601694-36601716 GATTGAGAACATAGGGATGAGGG + Intergenic
905389042 1:37624479-37624501 GCTTGGGAGCTGAGGGAGGTGGG - Intronic
906679190 1:47713639-47713661 GACTGAGAGCAGAGGCAGGATGG + Intergenic
907196860 1:52694106-52694128 GATTGGGAAGGGTGGGAGGATGG + Intronic
907788946 1:57642528-57642550 GATTGGGGCTTGAGGGAGGGAGG - Intronic
909420072 1:75454054-75454076 CATTGGGATCAGGGTGAGGATGG - Intronic
910257675 1:85264575-85264597 GAGTGAGATGAGAGGGAGGAAGG + Intergenic
910597252 1:88992979-88993001 GAAGGGGACAAGATGGAGGATGG + Intergenic
910985684 1:93002663-93002685 GAATGGGAATAGAGGGAGGTGGG - Intergenic
910989032 1:93035915-93035937 GAGTGGGAACTGAGGAAGGATGG + Intergenic
911437287 1:97877255-97877277 GATGGTGACCAGTGGGAAGATGG + Intronic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912857615 1:113184757-113184779 GATTGGGGAGAGAGGGAGGGAGG + Intergenic
913107723 1:115629791-115629813 GACAGAGACCAGAGGCAGGATGG - Intergenic
914754326 1:150554202-150554224 GCTTGGCACCTGAGGGAGAAGGG + Intronic
914908680 1:151767504-151767526 GATTGGGAAAAGAGGGAGTGGGG + Intronic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
916486370 1:165263332-165263354 GATTGGAGCCAGAGTGAGGTGGG - Intronic
916720441 1:167481461-167481483 AGTTGGGAGCAGAGGGAGGATGG + Intronic
917235385 1:172886267-172886289 GATTGGGAGCTGTGGGAAGAAGG + Intergenic
917273385 1:173303393-173303415 GCTTGGGCACAGAGGGAGGTGGG - Intergenic
917691693 1:177476577-177476599 GCTTGGGAACACAGTGAGGAAGG + Intergenic
918513448 1:185336573-185336595 GATTGGGAAGAGAGGGAGGCTGG + Intergenic
920578896 1:207086045-207086067 GAAGGGGAGCAGAGGGAGGCAGG + Intronic
921126107 1:212179553-212179575 GACAGGGATCAGAGGCAGGATGG - Intergenic
921275112 1:213511524-213511546 GATTCGGAGCAGAGGGGTGAAGG - Intergenic
921446584 1:215254357-215254379 GATTGGGGTGAGAGGGAGGTAGG + Intergenic
921967624 1:221107367-221107389 GAGTGGGAAGAGAGGAAGGAAGG - Intergenic
921997972 1:221442316-221442338 GATTAGGAGCAGAGAGAGAAGGG + Intergenic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
923372775 1:233328836-233328858 AAGTGGGGCCAGAGGGAGGTGGG + Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
1063424550 10:5941210-5941232 GATTGGGACGGGAGAGATGAAGG + Intronic
1063964859 10:11338932-11338954 AATTGGGAGCAGGGTGAGGATGG - Intergenic
1064125866 10:12659349-12659371 GAGTGAGACCAGAGGGAGTTGGG + Intronic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1069604837 10:69732550-69732572 GGTGGGGTCCAGAGAGAGGAGGG - Intergenic
1069614750 10:69800046-69800068 GATTGGGAACTGAAAGAGGAGGG - Intergenic
1070150336 10:73801241-73801263 GTCTTGGACCAGAGGGAGGCAGG + Intronic
1070566940 10:77610719-77610741 GACTGGGAGCAGAGGGAATAGGG + Intronic
1071599499 10:86951199-86951221 CCTTGGGACCAGAGGGAGCTGGG + Intronic
1071802106 10:89074968-89074990 GGTTGGGACAAGAGGCAGGCTGG + Intergenic
1072839102 10:98750737-98750759 GATTGGGAGAAGAGAGAAGAAGG + Intronic
1072917237 10:99545556-99545578 GAGGGGGAGCAGTGGGAGGAGGG + Intergenic
1073099868 10:101000732-101000754 GAGTGGGCCCAGAGAGGGGAGGG + Exonic
1073379165 10:103065024-103065046 GATGGAGTCCAGAGGGAAGATGG + Intronic
1074146378 10:110720723-110720745 GATGGGCACCACAGGGATGAGGG - Intronic
1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG + Intronic
1075091101 10:119444558-119444580 GCTGGGGACCATAAGGAGGAGGG - Intronic
1075329909 10:121566545-121566567 GACAGGGAAGAGAGGGAGGAAGG - Intronic
1075474159 10:122718992-122719014 GATGGGGGACAGAGGGAGGTGGG - Intergenic
1075532165 10:123238817-123238839 GACTGGGGGCAGAGGGTGGATGG - Intergenic
1075981810 10:126746797-126746819 GACTGGAATCAGAGGGAGGGAGG + Intergenic
1075993671 10:126859476-126859498 GTTTGGGTCCAGAGGAAGGTAGG - Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077329525 11:1977907-1977929 GATGGGGGCCACAGGGAGGCTGG - Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1080419163 11:32094803-32094825 AATGGGGACCAGAGGCAGGACGG + Intronic
1080646363 11:34191091-34191113 GATGGTGACCAAGGGGAGGAGGG - Intronic
1081714066 11:45236110-45236132 GCTGGGGAAAAGAGGGAGGAAGG - Intergenic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1082060545 11:47856317-47856339 GATTAGCAAGAGAGGGAGGAGGG - Intergenic
1082965362 11:58961483-58961505 GATTGGGCTCAGGGGGATGAGGG - Intronic
1083735540 11:64678232-64678254 GATGGGGAGGAGAGGGAAGAGGG - Intronic
1083998354 11:66283179-66283201 GATGGGGAACAGGGGCAGGATGG + Intronic
1084911719 11:72395034-72395056 GATTGGTAACATAGGGAGTAGGG - Intronic
1084956443 11:72694061-72694083 GATGGGGGCCACAGGGAGGGTGG - Intronic
1085920967 11:80956818-80956840 GGTTGGGACAGGAAGGAGGATGG - Intergenic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1087013736 11:93537078-93537100 TATAGGGATGAGAGGGAGGAAGG - Intronic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087845049 11:102963212-102963234 GATTGGAGCCAGGGTGAGGAGGG + Intergenic
1088588528 11:111380401-111380423 CACTGGGACCAGTGGTAGGAGGG - Intronic
1089320593 11:117624248-117624270 GATGGGGAGCAGAGCCAGGAGGG + Intronic
1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG + Intronic
1089768148 11:120783472-120783494 GAGAGGGAGCAGAGGGAGAAAGG - Intronic
1090135177 11:124190484-124190506 GCTTGGGCACAGAGGGAGGGGGG + Intergenic
1090188129 11:124751586-124751608 GCCGGGGACCAGAGGGAGGTGGG + Intronic
1090707478 11:129352146-129352168 AACTGGGAACAGAGTGAGGAAGG - Intergenic
1202812504 11_KI270721v1_random:33086-33108 GATGGGGGCCACAGGGAGGCTGG - Intergenic
1091789579 12:3264170-3264192 TAATGGGGCCAGAGGGAGGCAGG + Intronic
1092119490 12:6034115-6034137 GAATGGGAGGAGTGGGAGGATGG - Intronic
1092205128 12:6610129-6610151 GATTGGGTCCATAGGGTGGCTGG - Intergenic
1092409993 12:8245329-8245351 GATTGGAAGCAGACTGAGGAAGG + Intergenic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1092975803 12:13743881-13743903 GATGGGGTCCAGATGGAGGTAGG - Intronic
1094499412 12:31008911-31008933 TAATGGGGCCAGAGGGAGGCAGG - Intergenic
1095505357 12:42891451-42891473 GGATGGTACCAGAGGCAGGAAGG - Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1095981942 12:47979020-47979042 GATTGAGGACAAAGGGAGGAGGG - Intronic
1096789695 12:54037091-54037113 GATTGTGACAGGAAGGAGGAGGG - Intronic
1097888846 12:64757816-64757838 GGTTGGGACCAGAGGTTTGAAGG + Intronic
1099508904 12:83509451-83509473 GATAGGGACAGGAGGCAGGAGGG - Intergenic
1099538792 12:83878719-83878741 TATTGAGACCAAATGGAGGAGGG + Intergenic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1101001013 12:100357183-100357205 GGTGGGGAGCAGAGAGAGGAGGG + Exonic
1101525307 12:105523211-105523233 AAGTGGGAACAGAGGGAGGGAGG + Intergenic
1101737391 12:107473284-107473306 GGTAGTGACCAGAGGGAGGATGG - Intronic
1101994433 12:109514737-109514759 GATTGGGGACACAGGGAGGGAGG - Intronic
1102933621 12:116880086-116880108 GGTTGGTATCAGTGGGAGGAAGG - Intronic
1102953284 12:117044354-117044376 GAGTGGGAAGACAGGGAGGAAGG - Intronic
1102998664 12:117368510-117368532 GTTAAGGCCCAGAGGGAGGAGGG - Intronic
1103855120 12:123962641-123962663 GATGGGGAGTAGAGAGAGGAAGG + Intronic
1103990410 12:124795328-124795350 GACTGGGACCAGGGAGAGGAGGG - Intronic
1104473794 12:129053682-129053704 GATCGGGACTGGAAGGAGGAAGG + Intergenic
1105519177 13:21116242-21116264 GAGCAGGACCACAGGGAGGAAGG - Intergenic
1106026432 13:25960084-25960106 GAAGGGGCCCAGAGGCAGGAGGG + Intronic
1106176745 13:27338231-27338253 TAGTGGGACCAGAGTGAGTAGGG - Intergenic
1106214266 13:27680443-27680465 AAATGAGACCAGAGGGATGAAGG + Intergenic
1106384962 13:29275496-29275518 GGGTGGGAGCAGAGGGAGTAGGG - Intronic
1109743882 13:66594662-66594684 CACTGGGACCTGATGGAGGAGGG - Intronic
1111911754 13:94321058-94321080 GATGGGGGCGAGATGGAGGAAGG - Intronic
1113338051 13:109395549-109395571 GATTAGGTCATGAGGGAGGAGGG + Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1115880889 14:37916983-37917005 TATTGGGATGAGAGGGAAGAAGG + Intronic
1117320088 14:54613306-54613328 GGTGGAGACCAGAGGGAGGTGGG + Intronic
1117536721 14:56709641-56709663 GAGTGGGACCACAAGAAGGAAGG + Intronic
1117895896 14:60485978-60486000 GTTTGGGACCCCAGGGAGGGAGG - Exonic
1118597688 14:67448780-67448802 GACTGGAAACAGAGGGAGTAGGG + Intronic
1118693763 14:68364213-68364235 GAGTGGGCGCAGAGGGAGGGAGG - Intronic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1119933099 14:78566847-78566869 GATTTGGCCCAGAGGAAGGAAGG + Intronic
1121441425 14:93952077-93952099 GACTGGCAGCAGGGGGAGGAGGG + Intronic
1121667775 14:95686038-95686060 GACTGGGACCAGTGGAAGGGAGG + Intergenic
1122204803 14:100143086-100143108 GATGGATACCAGAGGAAGGAGGG + Intronic
1122867206 14:104611886-104611908 GCTGGGGACCCCAGGGAGGAGGG + Intergenic
1123030855 14:105450421-105450443 GCCTGGGCCTAGAGGGAGGAGGG - Intronic
1124702784 15:31931271-31931293 GAATGAGATCAAAGGGAGGAAGG + Intergenic
1125286271 15:38095889-38095911 GATTGGAGCTAGAGGGAAGAGGG - Intergenic
1125750689 15:42025630-42025652 GCTTGGGTACAGAGGGAGGTAGG - Intronic
1127302256 15:57666485-57666507 GATTTGGGGCAGAGGGAGGAGGG - Intronic
1128498297 15:68210592-68210614 AACTGAGGCCAGAGGGAGGAGGG - Intronic
1129254673 15:74327288-74327310 GCTGGGGCCCAGAGCGAGGAAGG - Intronic
1129300635 15:74623591-74623613 GGTTGGGACCAGTGGGTGGAGGG + Intronic
1131055298 15:89371323-89371345 AAATGGGACCAGAGCGCGGAGGG + Intergenic
1132020413 15:98356541-98356563 GAGCGGGAAGAGAGGGAGGAAGG + Intergenic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133588016 16:7214491-7214513 GGTTTGGACCAGAGAGATGATGG - Intronic
1133743204 16:8667138-8667160 GATGAGGACGAGAGGGAGAAAGG + Intergenic
1133744375 16:8675495-8675517 GATTGGGAGCGGTGGGAGGATGG - Intronic
1133773838 16:8883229-8883251 GAGGAGGACCATAGGGAGGAGGG - Intergenic
1133931220 16:10233598-10233620 GATTGGGACTAAAGGGAGCATGG + Intergenic
1134016946 16:10895434-10895456 GGAAGAGACCAGAGGGAGGAGGG - Intronic
1134804299 16:17111755-17111777 GATGGGCACAAGTGGGAGGAAGG + Intronic
1135110337 16:19685994-19686016 GATTGGCAGCAGAGGGAGCGAGG + Intronic
1135187699 16:20329437-20329459 AAATGGGAGCAGAGGGAGAAAGG - Intergenic
1135694746 16:24575885-24575907 GAGAGGGAGGAGAGGGAGGAGGG + Intergenic
1135724765 16:24845949-24845971 GCTTGGGACGAGCTGGAGGAAGG - Exonic
1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG + Intergenic
1137024112 16:35456196-35456218 GATTGGGAAAAGAGTGAGGCTGG + Intergenic
1137034750 16:35560290-35560312 GATCTGGACCATAGGTAGGATGG - Intergenic
1137367509 16:47873551-47873573 GCATGGCACAAGAGGGAGGAAGG - Intergenic
1137435099 16:48448346-48448368 GGATGGGGCCAGAGGAAGGAAGG - Intronic
1137683694 16:50371815-50371837 GCTTGGGGCAGGAGGGAGGAGGG - Intergenic
1138084277 16:54119531-54119553 GGTTGGGAGCAGAGGAGGGAAGG - Exonic
1138389669 16:56661303-56661325 GATGGTGCGCAGAGGGAGGAAGG - Intronic
1138476261 16:57272119-57272141 GGTTGGGCCCAGAAGGAGGAAGG - Intronic
1138611409 16:58128436-58128458 ATTTGGGATCAGTGGGAGGAAGG + Intronic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1139409822 16:66750743-66750765 GAGTGAGGCCAGAGGGAGTAAGG + Intronic
1139835001 16:69831042-69831064 GATTGAGGGCAGAGGGAGGCAGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1141892579 16:86936406-86936428 ATATGGGACCAGAGGGAGGGAGG + Intergenic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142137267 16:88457169-88457191 GGTTGGGCCCAGAGGGAGATGGG + Intronic
1142348623 16:89569806-89569828 GAAAGGGACCAGAGAGCGGAGGG + Intergenic
1142921388 17:3190150-3190172 GCTTGGGCACAGAGGGAGGCGGG - Intergenic
1143023871 17:3929888-3929910 GATTGGGATCAGAGGGTCAAGGG - Intronic
1146000064 17:29125650-29125672 GACTGGGCCCTGAGCGAGGAGGG + Intronic
1146057095 17:29586963-29586985 GCCCGGGAGCAGAGGGAGGATGG + Intronic
1146662579 17:34674480-34674502 GAGTGGGACACCAGGGAGGATGG - Intergenic
1147129105 17:38395616-38395638 TATTGCAGCCAGAGGGAGGAAGG + Intronic
1147165744 17:38592281-38592303 GATCGGAAGCTGAGGGAGGAGGG + Intronic
1147486151 17:40816722-40816744 GATTGTGGCCTGGGGGAGGAGGG + Intergenic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147622695 17:41878376-41878398 GATTGGGACATGAGGTAGTAGGG - Intronic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1147995551 17:44358363-44358385 GCTTGGGATCAGAGTGACGAAGG + Intronic
1148019220 17:44542415-44542437 GGTTGGAAGCAGAGGGAAGATGG - Intergenic
1149312432 17:55407657-55407679 GGTGGGGACAAGAGGGAGAAAGG + Intronic
1149366709 17:55952558-55952580 GCTTGGGCACAGAGGGAGGTGGG + Intergenic
1151345870 17:73500812-73500834 GATGGAGAACTGAGGGAGGATGG - Intronic
1151401366 17:73857996-73858018 GAGGGGGCCCTGAGGGAGGAGGG - Intergenic
1151443049 17:74145971-74145993 GACAGGGACAGGAGGGAGGAAGG - Intergenic
1152540060 17:80970324-80970346 GGTGGGCACCGGAGGGAGGATGG - Intergenic
1152726357 17:81948686-81948708 GAAAGGGACCTGAGGGCGGATGG - Intergenic
1153545910 18:6204429-6204451 GATTGTGACCAGAGGAATCATGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156473339 18:37390967-37390989 GACGGGGACAGGAGGGAGGACGG - Intronic
1156731442 18:40197981-40198003 GCTTGGGGACAGAGGGAGGCGGG - Intergenic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157786853 18:50491419-50491441 GATTGGTATCAGAGGTATGAGGG + Intergenic
1158187226 18:54784443-54784465 AATGGGGAACAGAGGGTGGAGGG - Intronic
1158699653 18:59734711-59734733 GTTTGGGACCATTGGGTGGATGG + Intergenic
1159328907 18:66962572-66962594 GATTGGGGAGAGTGGGAGGAGGG + Intergenic
1159904693 18:74078628-74078650 GAAAGGGGCCAGTGGGAGGAAGG - Intronic
1160970162 19:1764445-1764467 GGTGGGGACAAGAGGGAGGCTGG + Intronic
1162053108 19:8046845-8046867 GATGGGGAGGAGAAGGAGGAGGG - Intronic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163676872 19:18659820-18659842 GATCAGGAGCAGAGGGAGGTGGG - Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165408466 19:35644221-35644243 GAATGGGACCTGCGGGATGAAGG - Exonic
1165454208 19:35901252-35901274 TACTGGGTCCAGAGGGAGGCAGG + Intronic
1165485026 19:36090328-36090350 GATGGGGACAAGAGGTAGCAGGG + Intronic
1165948126 19:39457695-39457717 GACGAGGACCAGTGGGAGGATGG + Exonic
1166122667 19:40694770-40694792 CATTGAGACCTGAGGGATGAGGG - Intronic
1166228762 19:41413457-41413479 GCTTGGTAGCAGAGGGAGGCGGG - Intronic
1166388660 19:42396730-42396752 GTCTGGGACCCGAGGAAGGAGGG - Intergenic
1167276480 19:48543300-48543322 GATGGGGCCCAGCGGCAGGAAGG + Intergenic
1167323910 19:48812588-48812610 CATCTGGATCAGAGGGAGGAGGG - Intergenic
1167413978 19:49360992-49361014 GACAGAGACCAGAGGGAGGGGGG + Intronic
1167413987 19:49361015-49361037 GACAGAGACCAGAGGGAGGGGGG + Intronic
1167701839 19:51053040-51053062 GATTGTGACCAGAGGCTCGAAGG + Intergenic
1167738595 19:51311433-51311455 GATTGGGACTTGAAGGAGGAGGG + Intergenic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
925179498 2:1807776-1807798 AAATGGGACCAGAGGGTGGCAGG - Intronic
925216085 2:2096997-2097019 GACTGGGACCACAAGGATGAAGG - Intronic
927155725 2:20220078-20220100 AATTGGGACCTGAGAGAGCAGGG - Intronic
927649536 2:24903699-24903721 GAATGGGAGCAGGGGTAGGAGGG + Intronic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
932029769 2:68171810-68171832 GATTGTGAGCAGAGGAAGGGAGG + Intronic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932128876 2:69169464-69169486 GTTGGGGTCAAGAGGGAGGAGGG + Intronic
932334668 2:70923210-70923232 GACTGGGGACAGAGGAAGGAGGG - Intronic
932391461 2:71394241-71394263 GATTTGGGCCAAAGGGGGGATGG + Intronic
932668608 2:73718106-73718128 AAAAGGGAACAGAGGGAGGAGGG - Intergenic
932696620 2:73962223-73962245 GATTAGGACCACAGGAAGGCAGG + Intergenic
932823599 2:74921378-74921400 GATGGGAACCGGTGGGAGGATGG - Intergenic
932856341 2:75237473-75237495 GCTTGGGACCAGAGAGAGCCAGG + Intergenic
932861641 2:75298966-75298988 GCATGGGACAAGAGGGAGGAGGG + Intergenic
935050711 2:99522792-99522814 GCTTGGGCACAGAGGGAGGTGGG - Intergenic
935723524 2:106000586-106000608 GAGTGGGACCGGAGGGAGGTAGG - Intergenic
937153402 2:119701444-119701466 GATTGAGAGCAGAGGGAGCCTGG + Intergenic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
940971232 2:159899153-159899175 GAGTGGGAACAGACTGAGGATGG - Intronic
942449189 2:176098646-176098668 TCTTGGGATCAGAGGCAGGAGGG + Intergenic
943512711 2:188845777-188845799 GATTGGGAGCAGGAGGAGGTTGG + Intergenic
943713401 2:191123444-191123466 GGATGGGACCAGAAGAAGGAAGG - Intronic
944476319 2:200110417-200110439 GAGTAGTACCAGAGGGAGGTAGG - Intergenic
946072631 2:217047631-217047653 GAAGGGCACCAGTGGGAGGATGG - Intergenic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946921486 2:224585401-224585423 GATCCGGCCCAGAGGGTGGAGGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947390718 2:229636524-229636546 GACTAGGTCCAGAGAGAGGATGG + Intronic
948278642 2:236729341-236729363 GATTGGAACCAGGGCTAGGAAGG + Intergenic
948534317 2:238634837-238634859 GGATGTGACTAGAGGGAGGAGGG + Intergenic
1168842224 20:916854-916876 ACATGGAACCAGAGGGAGGAAGG - Intergenic
1168953934 20:1821120-1821142 TGTTGGGACAAGAGGCAGGAGGG - Intergenic
1169055700 20:2619033-2619055 GGTTGGGACTAGAGTGAGGCGGG - Intronic
1169524027 20:6403402-6403424 GTATGTGAACAGAGGGAGGAAGG + Intergenic
1169888610 20:10429725-10429747 GACTGTGACCCTAGGGAGGAGGG - Intronic
1170457557 20:16547597-16547619 GAGTGAGACCAGAGGCAGGTGGG - Intronic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1171489108 20:25504178-25504200 ACTTGGAACCAGAGGGAGGGAGG - Intronic
1172173847 20:32960701-32960723 TAAGGGGACCACAGGGAGGAGGG - Intronic
1172470727 20:35192672-35192694 GCTTGGGTACAGAGGGAGGTGGG - Intergenic
1172513597 20:35517133-35517155 GAATAGGTCCAGAGGGAGGCAGG - Exonic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173739287 20:45385677-45385699 GATTGGGGTGAGAGGAAGGAGGG - Intronic
1174031630 20:47633015-47633037 GAATGGGGCATGAGGGAGGAAGG - Intronic
1174294353 20:49534368-49534390 AATTGGGACCAGAGGCATGTGGG - Intronic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175175947 20:57112219-57112241 GATTGGGACCAGAACCAGGCTGG + Intergenic
1175366425 20:58459511-58459533 GATAGGGATCAGGAGGAGGAAGG + Exonic
1175419013 20:58819807-58819829 GGTTGGGACCAGAGGTAGATGGG - Intergenic
1176149550 20:63582848-63582870 GACTGCGTCCAGAGTGAGGACGG + Intergenic
1177437358 21:21072982-21073004 GATAGGGACTGGAGGTAGGAGGG - Intronic
1178413787 21:32387443-32387465 GAGTGGAACCAGAGAGAGGCAGG - Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1181630386 22:24148058-24148080 TCTTGGGACCAAAAGGAGGAGGG + Intronic
1182811173 22:33118087-33118109 AATTAGGACCAGAGGCAGGGTGG + Intergenic
1183160598 22:36110525-36110547 GATTTGGACAGGAGGGAGGGAGG + Intergenic
1183500221 22:38174442-38174464 GAGTGGGAACAGAGGGAGATTGG + Intronic
1183719308 22:39553078-39553100 GAATGAGACCCTAGGGAGGATGG - Intergenic
1184380209 22:44140646-44140668 GATGAGGAGCAGAGAGAGGAAGG - Intronic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
949212235 3:1516802-1516824 AATTGTAACCAGAGTGAGGATGG + Intergenic
949571016 3:5293286-5293308 GATTGGAGCCTGAGGGAGGATGG + Intergenic
949943749 3:9174171-9174193 GACAGGGACTAGAGGAAGGAGGG + Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
951216204 3:20027660-20027682 GAGTGGGAAAAGAAGGAGGAAGG + Intergenic
952255104 3:31688205-31688227 GTGTGAGACCAGAGGGAGGTGGG - Intronic
952482165 3:33772654-33772676 GATTGGGAGAAGAGGGAAGCAGG + Intergenic
954930056 3:54273398-54273420 GAATGGGATCAGAGGATGGAGGG - Intronic
955911416 3:63863408-63863430 GGGTGGGACCAGAGGGAGTCCGG - Intronic
957055231 3:75437453-75437475 GATTGGAAGCAGATTGAGGAAGG + Intergenic
958988646 3:100814440-100814462 GATTTGGATTAGAGGGTGGAAGG - Intronic
959157083 3:102679711-102679733 GATTGGGATCAGTGGAAAGAGGG + Intergenic
960045513 3:113193582-113193604 GATGTGGGCCACAGGGAGGAAGG + Intergenic
961106042 3:124242553-124242575 GATTTGGAACAGAGGGACAATGG + Intronic
961457576 3:127031725-127031747 GATTGGGCACAGCGGGAGGTGGG + Intronic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
962878203 3:139552233-139552255 GAGGGGGACCAGAGTTAGGAGGG + Intergenic
962979620 3:140476073-140476095 GATTGGTGCCAGTGGGAGGGAGG + Intronic
963000863 3:140680337-140680359 GAATGAGACCAGAGTGAGGCAGG - Intronic
963208112 3:142657253-142657275 GATTGCCCCCACAGGGAGGAAGG - Intronic
963247273 3:143074854-143074876 GGCTTGGAGCAGAGGGAGGATGG + Intergenic
963256797 3:143152998-143153020 GACTGGGGCAGGAGGGAGGAGGG - Intergenic
964592484 3:158379838-158379860 AAATGGGACAAGAGGGAGGGAGG - Intronic
965555362 3:170012834-170012856 GATTAGTACAAAAGGGAGGAGGG + Intergenic
966769938 3:183494598-183494620 GGTAGGGACCAGAGGGAGCCTGG + Intronic
966845815 3:184128905-184128927 GCTTGAATCCAGAGGGAGGATGG - Intergenic
967109877 3:186283879-186283901 GAGTCAGACCAGAGGAAGGAAGG - Intronic
967765955 3:193279840-193279862 GATTGGGACCAGATTGTGGAAGG - Intronic
968937118 4:3617268-3617290 GAATGGGATGAGAGGGAAGAAGG - Intergenic
969044135 4:4324228-4324250 GCTTGAGCACAGAGGGAGGAGGG + Intergenic
969207670 4:5659491-5659513 TGTTGGGACGGGAGGGAGGATGG + Intronic
969467453 4:7366205-7366227 GAAAGGGAAGAGAGGGAGGAAGG - Intronic
969755956 4:9150899-9150921 GATTGGAAGCAGATTGAGGAAGG - Intergenic
971114284 4:23626330-23626352 GAATGGGATGAGAGGGAGAAGGG + Intergenic
971521635 4:27559738-27559760 GCTTGGAAGCTGAGGGAGGATGG + Intergenic
971769845 4:30882158-30882180 GAAGGGGAAGAGAGGGAGGAAGG - Intronic
974863550 4:67552474-67552496 GCTTGGGCACAGAGGGAGGTGGG - Intergenic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976546598 4:86342992-86343014 GATTGGGGCCAGACTGAGGGAGG - Intronic
978688382 4:111477429-111477451 GATGGTGACGAGAGGTAGGAAGG - Intergenic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
981647481 4:147017149-147017171 GATTGGGAGCAGAGGCTGAAAGG + Intergenic
981919125 4:150067741-150067763 GAACAGGACCAGAGGTAGGAAGG + Intergenic
982471884 4:155802357-155802379 CATTGGCAACAGACGGAGGAAGG - Exonic
982964047 4:161879577-161879599 GTGTGGGACAAGAGTGAGGAAGG - Intronic
983334979 4:166379477-166379499 GATTGGGTCCTGCGTGAGGAAGG + Intergenic
983680471 4:170347509-170347531 GCTTGGGCACAGAGGGAGGTGGG - Intergenic
985958064 5:3279049-3279071 GAATGGGAGGAGAGGAAGGAGGG - Intergenic
986490724 5:8286905-8286927 GAGAGGGAGGAGAGGGAGGAAGG - Intergenic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
987692464 5:21284266-21284288 TATAGGGACTAGAGCGAGGAAGG - Intergenic
988906378 5:35794903-35794925 GAGGGGGACCTGAGGGCGGAAGG - Intronic
989412847 5:41140312-41140334 GTTTGGGGGAAGAGGGAGGATGG + Intergenic
990295660 5:54399031-54399053 AATAGTGAACAGAGGGAGGAAGG - Intergenic
990991002 5:61684075-61684097 GATTAGGAACGGAGGGAGGGAGG - Intronic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
995243177 5:109908355-109908377 GATAGGCAGCAGAGGGAAGATGG - Intergenic
995551417 5:113285508-113285530 GACTGGGAGCAGAGTGAGCAGGG - Intronic
996306862 5:122056943-122056965 AATTGGGACCAGATAAAGGAAGG + Intronic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
998394718 5:141811439-141811461 GAATGAGGCCAGGGGGAGGAAGG - Intergenic
998490506 5:142542363-142542385 AACTGTGACGAGAGGGAGGAAGG - Intergenic
999324358 5:150634267-150634289 GATCTGGACCAGAGAGGGGAAGG + Intronic
1000041250 5:157486682-157486704 GAGTGCCAGCAGAGGGAGGAGGG - Intronic
1000346958 5:160322258-160322280 GGTTGGGAAAAGAGGGAAGAGGG - Intronic
1000628945 5:163570100-163570122 GATTGGCACCAGTGGAAGGGAGG + Intergenic
1001245668 5:170104442-170104464 GGCTGGGACAAGATGGAGGATGG + Intergenic
1001594526 5:172889315-172889337 AATTGGGCCCAGGGGTAGGAAGG + Intronic
1002001286 5:176197587-176197609 GCTTGGGCACAGAGGGAGGTGGG - Intergenic
1002253053 5:177941382-177941404 GCTTGGGCACAGAGGGAGGTGGG + Intergenic
1002437781 5:179242747-179242769 GACTGGGATCTGAGGGAAGAGGG - Intronic
1002567425 5:180119731-180119753 AGCTGGGCCCAGAGGGAGGAGGG - Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1003603582 6:7541170-7541192 GACTAGGACCACAGTGAGGAGGG - Intergenic
1003838417 6:10095171-10095193 TGGTGGGCCCAGAGGGAGGAAGG + Intronic
1005277642 6:24237208-24237230 AATTGAGAGCAGAGGGTGGAAGG + Intronic
1006404709 6:33838196-33838218 GTTTGCGGGCAGAGGGAGGAGGG + Intergenic
1006454447 6:34123859-34123881 GCTGGAGACCAGAGAGAGGAAGG - Intronic
1006688778 6:35861630-35861652 GCCTGGGACCAGAGCGGGGAGGG - Intronic
1007027223 6:38588450-38588472 GATTAGGCCCAGTTGGAGGAGGG - Intronic
1007425753 6:41744841-41744863 GAGTGGGAAGAGAGGAAGGAGGG - Intronic
1007778445 6:44237373-44237395 GGTTGGGGCCAGAGGGAGTTGGG - Intergenic
1007788584 6:44296484-44296506 GCTGGGGACCTGAGGAAGGATGG - Intronic
1011227119 6:85119789-85119811 GGTTGGGACCCCAAGGAGGAGGG - Intergenic
1012860510 6:104553730-104553752 GGTTGTTACCAGAGGCAGGAGGG + Intergenic
1014787071 6:125631341-125631363 GCTTGGGGCCAGTGGGAGGCAGG - Intergenic
1015231593 6:130921184-130921206 GACTGAGACCAGAGGCAGGAAGG - Intronic
1015816757 6:137219190-137219212 GGTCGGGACGAGAGGGAGGGAGG - Intronic
1017671255 6:156771476-156771498 TATGGGGACCAGAGGGACTATGG - Intergenic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018066406 6:160127599-160127621 GTTTGGGAGCAGAGGAAGCATGG + Intronic
1018638986 6:165889821-165889843 GAGTGGGGCGAGAGGGAGGGAGG - Intronic
1018701876 6:166433485-166433507 GGACGGGACCAGTGGGAGGAGGG + Intronic
1018705347 6:166460194-166460216 GTTTGGGCCCAGAGGGGGCATGG - Intronic
1018788852 6:167130974-167130996 GAGGGGGTCCAGAGGGAGGGTGG - Intronic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1018867734 6:167758941-167758963 GACGGGGGGCAGAGGGAGGAGGG - Intergenic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019480692 7:1265349-1265371 GGCTGGGAGCAGAGGGAGGGGGG + Intergenic
1019508346 7:1404786-1404808 GACTGGGAGGAGTGGGAGGAGGG + Intergenic
1020405828 7:7833079-7833101 GCTTGGGACCACAGTGTGGAGGG + Intronic
1021864645 7:24943027-24943049 GTTTGGAGCCAGAGAGAGGATGG - Intronic
1022614464 7:31915080-31915102 GATTGGTTCCAGAGGGATGATGG - Intronic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1023305108 7:38817816-38817838 GTTTGTGACCGGAGGGAAGAAGG - Exonic
1023742413 7:43292637-43292659 GACTGGGAACAGAGCTAGGAAGG + Intronic
1023817219 7:43960303-43960325 GACTGGGGGCAGAGGGATGAGGG + Intergenic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1024639576 7:51317775-51317797 GCAGGGGATCAGAGGGAGGAAGG - Intergenic
1029405305 7:100371435-100371457 GATTGGGATCAGAGGAAAGCAGG + Intronic
1029493960 7:100887292-100887314 GTTTGGGAACAGAGGAAGGAAGG - Intronic
1030306200 7:108020975-108020997 GACTAGGACCAGAGGGACCATGG + Intergenic
1030509588 7:110468320-110468342 GATTGGGACTAGAGGGAGAAGGG - Intergenic
1030768991 7:113450054-113450076 GATTGGGAAAAGATGGGGGATGG + Intergenic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031445246 7:121845751-121845773 GATGGGGATAAAAGGGAGGAAGG + Intergenic
1032269372 7:130389538-130389560 GATTGGGGCTGGAGTGAGGATGG + Intergenic
1032664481 7:134021910-134021932 TATTGGGGACAGAGGGAGGGAGG + Intronic
1033073186 7:138223409-138223431 GATTGAGAGAAGAGAGAGGAAGG + Intergenic
1033314405 7:140285667-140285689 GCCTGGGACCAGAGGCAGTAGGG - Intergenic
1033643829 7:143286299-143286321 CATTGGCATCAGCGGGAGGAGGG + Intronic
1033685431 7:143636028-143636050 GCTCGGGCACAGAGGGAGGAGGG - Intronic
1033688601 7:143715246-143715268 GCTCGGGCACAGAGGGAGGAGGG - Intronic
1033699183 7:143821592-143821614 GCTCGGGCACAGAGGGAGGAGGG + Intergenic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034088587 7:148343136-148343158 AATTGGGAACAGAGAGTGGAGGG - Intronic
1034422210 7:150995997-150996019 GGATGGGAGCAGAGGGAGGAGGG - Intronic
1034769965 7:153764473-153764495 GGTTGGGTTCAGGGGGAGGAGGG + Intergenic
1035636973 8:1155007-1155029 GAGTGGGAACAGAAGCAGGATGG - Intergenic
1035994883 8:4534579-4534601 GAATGGGGAAAGAGGGAGGAGGG - Intronic
1036519034 8:9473365-9473387 GTTAGGGAAGAGAGGGAGGATGG - Intergenic
1036850359 8:12196412-12196434 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1036871723 8:12438685-12438707 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1037709624 8:21345308-21345330 AGTGGGGACCAGGGGGAGGAAGG + Intergenic
1037760328 8:21737703-21737725 GGCGGGGACCAGAGGGAGGGAGG - Intronic
1038574791 8:28695714-28695736 GGCTGGGACCAGAGGGAAGGAGG + Intronic
1039048831 8:33474337-33474359 GGTCGGGACCAGAGGGAGGCAGG - Intronic
1040589388 8:48776374-48776396 GCTTGGGAAAAGAGGGAGAATGG - Intergenic
1044299990 8:90572755-90572777 GATAGAGACAAGAGAGAGGAAGG + Intergenic
1045016360 8:98004664-98004686 GACTGGGACAAGAGGCCGGAGGG + Intronic
1045056406 8:98371970-98371992 GAGTGGGATCAGGGGGAGGGGGG + Intergenic
1045264224 8:100605280-100605302 GGTTGGGAGAAGTGGGAGGAAGG + Intronic
1045383301 8:101647873-101647895 GATTGGGAGGAGGGGGAGGAGGG + Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1046044366 8:108946754-108946776 GATTGAGACTAGAGGTAGGGAGG - Intergenic
1046072922 8:109280522-109280544 GATTGTGAGGAGTGGGAGGATGG + Intronic
1046366320 8:113237110-113237132 GATTTGGACAAAAGGGATGAGGG - Intronic
1046993358 8:120486649-120486671 TATTGGAAGCCGAGGGAGGAGGG + Intronic
1049240376 8:141534917-141534939 GAGGAGGACCAGTGGGAGGAGGG - Intergenic
1049341384 8:142114425-142114447 GAATGAGAAGAGAGGGAGGAAGG + Intergenic
1049409563 8:142466432-142466454 GAGAGGGGCCAGAGGAAGGAGGG + Intronic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1051038445 9:12776731-12776753 GATTGAGACTTGAGGGAGAAGGG - Intronic
1051167175 9:14275792-14275814 GATAGGGAAGTGAGGGAGGAGGG - Intronic
1051350152 9:16191414-16191436 ACTTGGGAGCAGAGGGAGGAAGG + Intergenic
1052140932 9:24982213-24982235 GAATGGTGCCAGTGGGAGGAGGG + Intergenic
1052317102 9:27126793-27126815 GATTGGGGCCAGAGGATGGAAGG + Intronic
1052786549 9:32833421-32833443 GGTTTGGAACAGAGGGAGGGAGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1052989253 9:34509165-34509187 GGTGGGGACCAGGGGGTGGAGGG + Intronic
1053414253 9:37936871-37936893 AGTTGGGACCTTAGGGAGGAAGG + Intronic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1056128748 9:83563559-83563581 TAATGGAACCAGAGGAAGGATGG - Intergenic
1057747130 9:97761341-97761363 GATTGGCAGCAGAGGGAGGCAGG + Intergenic
1058483903 9:105424164-105424186 GAAGAGGACCAGAGAGAGGAGGG - Intronic
1059354328 9:113687410-113687432 GATGGGGAAGGGAGGGAGGAGGG + Intergenic
1059778538 9:117501659-117501681 CATTGGGACCTGAGGGTGGAGGG - Intergenic
1060823088 9:126672652-126672674 GAATGGGGCGAGAGGGAGGCAGG - Intronic
1060984134 9:127809970-127809992 GATTGGTACCGCAGGGAGAACGG + Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061852355 9:133423669-133423691 GATGGGGGCCAGAGGCAGGTGGG + Intronic
1062432228 9:136531347-136531369 GATGGGGACCAGAGCGGGGCAGG + Intronic
1185603620 X:1355037-1355059 GAAGGGGAGCAGATGGAGGAAGG + Intronic
1185802990 X:3030161-3030183 GCTTGGAAGCAGAGGCAGGAAGG + Intronic
1186873852 X:13797982-13798004 GAGTGGGAGCATAGGAAGGATGG + Intronic
1187094002 X:16127442-16127464 GCATGGGAGGAGAGGGAGGATGG - Intronic
1187772382 X:22714558-22714580 TATTGGGACAATAGGAAGGAAGG + Intergenic
1189566724 X:42249415-42249437 GAGTGGGATCAGGGGGAGCACGG - Intergenic
1190497513 X:51040803-51040825 GATTGAACCCAGAGGGAGAAAGG + Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1192213595 X:69142933-69142955 GGTTGGGAGAAGTGGGAGGAGGG - Intergenic
1192435247 X:71139358-71139380 CATGGGGACCAGAATGAGGATGG + Intronic
1193552760 X:82918633-82918655 GATGGTGAACAGTGGGAGGAGGG - Intergenic
1195036554 X:100975379-100975401 GAGTGGGAGCTGAGGAAGGAGGG - Intronic
1197365846 X:125563621-125563643 TCTTGGGAGCAGGGGGAGGAGGG + Intergenic
1197487282 X:127068726-127068748 GATAGTTACCAGAGGCAGGAAGG - Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197916968 X:131546186-131546208 AATTGGGGGTAGAGGGAGGAAGG - Intergenic
1198008986 X:132531238-132531260 GATTGGTACAGGAGGGAGGGTGG + Intergenic
1198376715 X:136048164-136048186 GATTGTAACCAGAAGGATGAAGG + Intergenic
1199483198 X:148321295-148321317 GCTTGTCACCAGAGGAAGGAAGG - Intergenic
1199851528 X:151727519-151727541 GATTTGGAGCAGAGGGACGGAGG + Intergenic
1200046757 X:153407272-153407294 GATAGGGACCAAAGCCAGGAGGG - Intergenic
1201625630 Y:16011858-16011880 GAGTGGGAAGAGAGGAAGGAAGG + Intergenic