ID: 1037455287

View in Genome Browser
Species Human (GRCh38)
Location 8:19057441-19057463
Sequence CACAGAAGGCGTGACCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037455287_1037455289 -5 Left 1037455287 8:19057441-19057463 CCACTCTGGTCACGCCTTCTGTG 0: 1
1: 0
2: 1
3: 11
4: 186
Right 1037455289 8:19057459-19057481 CTGTGTTCTTTGCAAGATCCAGG No data
1037455287_1037455291 25 Left 1037455287 8:19057441-19057463 CCACTCTGGTCACGCCTTCTGTG 0: 1
1: 0
2: 1
3: 11
4: 186
Right 1037455291 8:19057489-19057511 TTCAATGATCTCTACTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037455287 Original CRISPR CACAGAAGGCGTGACCAGAG TGG (reversed) Intronic
901173610 1:7282599-7282621 TCCAGAAGGAGTGGCCAGAGAGG - Intronic
902126721 1:14220108-14220130 CACAGAAGGCATGACCAAAGAGG - Intergenic
902837429 1:19056040-19056062 CACAGAAGCAGTGAGCAGAACGG + Intergenic
903566884 1:24274434-24274456 CAAAGATGTCCTGACCAGAGAGG + Intergenic
905242605 1:36590498-36590520 CACTCAAGGCCTGGCCAGAGGGG + Intergenic
905939076 1:41848675-41848697 GGCAGAAGGCGAGAGCAGAGAGG + Intronic
906119604 1:43380272-43380294 CAGAGAAGGAATGGCCAGAGAGG + Intergenic
909265506 1:73553035-73553057 TACAGAAGGTGTGACCATGGAGG - Intergenic
909741566 1:79036189-79036211 TACAGAAAGCATGACCAGGGAGG - Intergenic
914984365 1:152443299-152443321 CATAGAAGAGGTGACCTGAGAGG + Intergenic
916192729 1:162194763-162194785 CACAGAAGGGGAGGCAAGAGGGG + Intronic
918864025 1:189871080-189871102 GAAAGAAGGCCTGAGCAGAGAGG + Intergenic
919524556 1:198631662-198631684 CACAGAAGGCCACTCCAGAGTGG + Intergenic
922914182 1:229241873-229241895 AACAGAAGGCATGACTAGGGAGG - Intergenic
924954446 1:248913205-248913227 CACAGAAGGGGTACCCACAGGGG - Intronic
1063521834 10:6748337-6748359 CAGAGCAGGCATGTCCAGAGTGG - Intergenic
1064861997 10:19836218-19836240 CAGAGAGGGAGTGGCCAGAGGGG + Intronic
1067628333 10:47941964-47941986 CAGAGAAGGCTTGACAAGACAGG + Intergenic
1068019140 10:51558852-51558874 AACTGAAGGTGTGAACAGAGTGG + Intronic
1071471282 10:85985703-85985725 GAAAGATGGCCTGACCAGAGGGG - Intronic
1072365326 10:94703417-94703439 CACAGATGCCATGCCCAGAGAGG + Intronic
1073571262 10:104582866-104582888 CCCAGAAGGGGAGACCCGAGAGG + Intergenic
1075127560 10:119712624-119712646 CTCTGAAGGCCTGAACAGAGAGG - Intergenic
1078187188 11:9062047-9062069 CAGAGAAGTCTGGACCAGAGAGG + Intronic
1080584649 11:33670604-33670626 CACAGAAAATCTGACCAGAGTGG - Exonic
1081732298 11:45380088-45380110 CACAGAAGGAGCCACCACAGTGG + Intergenic
1083310512 11:61781322-61781344 CACAGAAAGCCTTACCTGAGCGG - Exonic
1088325687 11:108598617-108598639 CACATAAGCGGTGACCTGAGGGG + Intergenic
1088696239 11:112368463-112368485 CAGAGAAGACCAGACCAGAGGGG - Intergenic
1092690930 12:11109125-11109147 CAGAGATGCCCTGACCAGAGAGG - Intronic
1092831220 12:12446319-12446341 CACAGAAGGCCTTCCCAGAAAGG + Intronic
1094183874 12:27620296-27620318 CACAGAAGGCGTGGTGGGAGTGG - Intronic
1094498334 12:31002989-31003011 CACAGAAGGGGTGAGCAGGCAGG - Intergenic
1099510643 12:83531530-83531552 GACAGAAATGGTGACCAGAGAGG - Intergenic
1102753527 12:115317686-115317708 CACAGAAGCAGAGAGCAGAGTGG + Intergenic
1103832109 12:123788250-123788272 CAGAGAAGGAGTGGCCAAAGAGG - Intronic
1104134365 12:125923367-125923389 CACAGAAGGAGGGAGCAGAGAGG + Intergenic
1104358575 12:128111107-128111129 CACAGAGAGAGTGAGCAGAGGGG + Intergenic
1104434740 12:128747099-128747121 CACAGCAGGCCTGGCCAGATGGG + Intergenic
1104930553 12:132337240-132337262 CACAGAAGGCACAGCCAGAGGGG - Intergenic
1107887664 13:44887409-44887431 CACAGAAATCATGACCAGAAAGG + Intergenic
1111354495 13:87080358-87080380 CTCAGAAGCAGTTACCAGAGGGG + Intergenic
1114817699 14:25979617-25979639 CACAGATGCCCTGCCCAGAGAGG - Intergenic
1114994278 14:28328372-28328394 CAGAGGAGCCCTGACCAGAGGGG - Intergenic
1116654820 14:47638889-47638911 AATAGAAGGTGAGACCAGAGAGG - Intronic
1117868769 14:60176013-60176035 CACAGAAGGCATCAACAAAGTGG + Intergenic
1118392113 14:65304304-65304326 CATGGTAGGCATGACCAGAGTGG + Intergenic
1119260803 14:73237293-73237315 GACAGACGGGGTGACCAGAGTGG + Intergenic
1119739180 14:77003108-77003130 CATAGCAGGCCTGTCCAGAGGGG - Intergenic
1120495817 14:85233936-85233958 GACAGAAGGACTGACCGGAGAGG - Intergenic
1120947196 14:90009329-90009351 AAGAAAAGGAGTGACCAGAGAGG + Intronic
1121651512 14:95562367-95562389 CAAAGAAGACATCACCAGAGTGG - Intergenic
1122432763 14:101666402-101666424 CACAGAACTGGTGACCAGCGGGG - Intergenic
1123508501 15:20971116-20971138 CACAGAAACTGAGACCAGAGAGG + Intergenic
1123565723 15:21544865-21544887 CACAGAAACTGAGACCAGAGAGG + Intergenic
1123601986 15:21982152-21982174 CACAGAAACTGAGACCAGAGAGG + Intergenic
1124319263 15:28700821-28700843 CAAAGAATACGTGAACAGAGAGG + Intergenic
1124893976 15:33758601-33758623 CAGAGATGGCCTGCCCAGAGAGG - Intronic
1125093192 15:35819596-35819618 GACAGAAGGATTGACCAGTGAGG - Intergenic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132207690 15:99997751-99997773 CACAGAGGGAGTGACTTGAGTGG + Intronic
1202974094 15_KI270727v1_random:271958-271980 CACAGAAACTGAGACCAGAGAGG + Intergenic
1133914885 16:10100662-10100684 CACAGATGGAGTGAACAGTGTGG - Intronic
1136091128 16:27920795-27920817 CACAGCAGGCGTGTCCAGACAGG + Intronic
1138565656 16:57830997-57831019 CAATTAAGGCGTCACCAGAGTGG + Intronic
1139354642 16:66360237-66360259 CACAGAAGGCTTGGGCAGTGGGG + Intergenic
1142150140 16:88509054-88509076 CACAGAAACCGAGGCCAGAGGGG - Intronic
1143175272 17:4951511-4951533 AACAGACTGCTTGACCAGAGGGG + Intronic
1144589344 17:16511009-16511031 CTCAGAAGCCTTGGCCAGAGTGG - Intergenic
1146610589 17:34301709-34301731 CACAGGAGCCTTGCCCAGAGGGG - Intergenic
1148764564 17:50029523-50029545 CATAGAGGGAGTCACCAGAGAGG + Intergenic
1149585664 17:57784527-57784549 CAGAGAAGGACTGGCCAGAGAGG - Intergenic
1152500697 17:80706865-80706887 CACAGAAGACGTGAACAAATGGG - Intronic
1153875542 18:9367372-9367394 CACAGAAGCGGTGAGCAGAATGG - Intronic
1156490427 18:37492753-37492775 CATAGAAGGTGAGACCAAAGTGG - Intronic
1158142532 18:54270094-54270116 CACCGGAGACGTGACCACAGCGG - Intronic
1158453390 18:57586491-57586513 CTGAGAAGGCGTGGGCAGAGCGG - Intronic
1159027104 18:63193416-63193438 CACAGAAGCCGAGAACACAGTGG - Intronic
1159562221 18:70007713-70007735 CAGAGATGGCCTGCCCAGAGAGG - Intronic
1161109479 19:2461436-2461458 TACAGGAGGCGGGGCCAGAGGGG + Intergenic
1161725123 19:5924125-5924147 CCCAGACGGAGTGACCAGTGTGG - Intronic
1162562807 19:11427165-11427187 CACAGAAGGGGTGGCCAGGGAGG - Intronic
1163621554 19:18363814-18363836 CACAGCTGCCGTGACCAGGGAGG + Exonic
1163824270 19:19514337-19514359 CCGAGAGGGCGAGACCAGAGGGG - Exonic
1164878993 19:31715043-31715065 CATAGAAGGCAGGACCAGAAGGG - Intergenic
1166155496 19:40908615-40908637 CAGAGAAGGCCTGGCCAGAATGG - Intergenic
927554897 2:24024432-24024454 CTGAGAAGGGGTGGCCAGAGTGG - Intronic
930860320 2:56065234-56065256 CAGAGATGCCGTGCCCAGAGAGG + Intergenic
931644767 2:64411893-64411915 CTGAGAAGGTGTGACCAGTGAGG - Intergenic
932606994 2:73172166-73172188 GAGAGAAGGCTTGACCAGAAGGG - Intergenic
933413172 2:81950888-81950910 CACAGATGCCCTGCCCAGAGGGG + Intergenic
933925434 2:87088245-87088267 GAGAGAAGGCTTGACCAGAAGGG + Intergenic
945207255 2:207344913-207344935 CACAGATGCCCTGCCCAGAGAGG - Intergenic
945467068 2:210181772-210181794 CAGAGATGGCCTGCCCAGAGAGG - Intergenic
949037477 2:241822483-241822505 CCCAGAAGGCGGGAGCAGGGTGG - Intergenic
1169258747 20:4119983-4120005 CAGAGAAGGAGTGTCAAGAGAGG + Intergenic
1169320022 20:4625007-4625029 CAGAGATGCCGTGCCCAGAGAGG + Intergenic
1173018027 20:39244474-39244496 CACAGAAGGAGTCAGGAGAGGGG - Intergenic
1173226868 20:41167263-41167285 CACAGGAGGTGAGACCAGTGAGG + Intronic
1173316768 20:41951495-41951517 CACAGAAGCCATGAAAAGAGTGG - Intergenic
1174642203 20:52054298-52054320 CACAGCAGGCAGGACCACAGAGG + Intronic
1175533472 20:59690536-59690558 CACAGGAGGTGTGTGCAGAGTGG + Intronic
1176049823 20:63112841-63112863 CACAGAAGGAGAGGCCCGAGAGG + Intergenic
1176119873 20:63449593-63449615 CAGTGAAGCCGTGAGCAGAGTGG - Intronic
1178199954 21:30392116-30392138 CAGACAAGCCGTGTCCAGAGGGG + Intronic
1179356573 21:40665716-40665738 CACAGATGGGGTGCCCAGGGTGG - Intronic
1179637838 21:42724808-42724830 CACAGAAGGTGTGGACAGAGTGG + Intronic
1181592576 22:23894365-23894387 CACAAAAGGCGGGACCACAGTGG + Exonic
1182773629 22:32814513-32814535 AAGAGATGGCTTGACCAGAGTGG + Intronic
1183660814 22:39220190-39220212 CACAGAAGGAGTGAGCAATGGGG + Intergenic
1185271975 22:49933991-49934013 CACAGACTCAGTGACCAGAGGGG - Intergenic
1185295809 22:50054175-50054197 CTCAGAAGGCCTGACCACAGAGG - Intronic
949969706 3:9394786-9394808 CATGGAAGGCATGACCAAAGGGG + Intergenic
950713641 3:14832006-14832028 CACAGATGGCAGAACCAGAGAGG + Intronic
951574619 3:24101107-24101129 CACAGATTCAGTGACCAGAGAGG - Intergenic
953956992 3:47239340-47239362 CAAAGAAAGTGTGAGCAGAGAGG + Intronic
954577779 3:51686270-51686292 CGCAGAGGGCGTGGCCAGTGTGG + Intronic
963934248 3:151035945-151035967 CAAAGAAGGCATAACTAGAGAGG - Intergenic
964332615 3:155620717-155620739 CAGAGATGGCCTGCCCAGAGAGG - Intronic
965497294 3:169413843-169413865 CAGAGATGGCTTGCCCAGAGAGG - Intronic
969511998 4:7623440-7623462 CTGAGAAGGAGTGGCCAGAGAGG - Intronic
970115062 4:12685674-12685696 CAAAGAAGGTGTAGCCAGAGGGG - Intergenic
971697906 4:29930095-29930117 CAGAGATGGCCTGCCCAGAGAGG - Intergenic
971898272 4:32624451-32624473 CACAGAACCCATGACCATAGGGG + Intergenic
973228199 4:47810673-47810695 AAGAGAAGGAATGACCAGAGAGG - Intronic
973837521 4:54825156-54825178 CACAGATGCCTTGCCCAGAGAGG - Intergenic
973947529 4:55973963-55973985 CCAAGAAGGATTGACCAGAGAGG - Intronic
974326274 4:60419044-60419066 CAGAGATGCCCTGACCAGAGAGG + Intergenic
977723456 4:100267457-100267479 CAGAGATGGCCTGCCCAGAGAGG + Intergenic
978236889 4:106471243-106471265 CAGAGATGCCCTGACCAGAGAGG + Intergenic
978407402 4:108394899-108394921 CACAGAAGGCCTGTCCTGTGGGG - Intergenic
979417486 4:120461112-120461134 CAGAGAAGCCCTGCCCAGAGAGG - Intergenic
980007175 4:127556000-127556022 CAGAGAAGGAGTGGTCAGAGAGG + Intergenic
982262461 4:153506913-153506935 CACAGAAGAGGAGACCAGAGTGG + Intronic
982909192 4:161117931-161117953 CAGAGATGCCCTGACCAGAGAGG + Intergenic
983283270 4:165707916-165707938 CACAGGAGGGGTGACCAAAAGGG + Intergenic
986045696 5:4035559-4035581 CACAGAATGGGTGAGCAGAGGGG + Intergenic
986466935 5:8035032-8035054 CAGAGAGGGCGGGGCCAGAGAGG + Intergenic
988509830 5:31855460-31855482 CAGGGAAGGGGTGCCCAGAGGGG + Intronic
990098884 5:52157099-52157121 CAGAGAAGGCTTGCCCAGAGAGG - Intergenic
990957950 5:61362576-61362598 CAATGAAGGAGTGGCCAGAGAGG - Intronic
991530217 5:67606441-67606463 TACAGCAGGGGTGGCCAGAGAGG + Intergenic
992506046 5:77388755-77388777 CAGAGATGGCCTGCCCAGAGAGG + Intronic
992977671 5:82137909-82137931 CACAGATGCCCTGCCCAGAGAGG + Intronic
996148806 5:120009993-120010015 CAGAGAAGGCATGCCAAGAGTGG + Intergenic
999147922 5:149407958-149407980 GACTGAAGGCTTGGCCAGAGGGG + Intergenic
1000798350 5:165693095-165693117 CACAGATGCCCTGCCCAGAGAGG + Intergenic
1003280929 6:4690684-4690706 CACAGAAGGCTAGGACAGAGCGG - Intergenic
1004927230 6:20427552-20427574 CACAGAAGGTCTGAGCAGAAGGG - Intronic
1007578148 6:42939179-42939201 CACAGGAGGGGTAAGCAGAGAGG - Exonic
1009290129 6:61870348-61870370 CAGAGATGCCCTGACCAGAGAGG - Intronic
1014822887 6:126012810-126012832 CACAGAAGGAGATACCAAAGGGG + Exonic
1014836526 6:126166795-126166817 CAGAGATGGCCTGCCCAGAGAGG + Intergenic
1017866975 6:158452365-158452387 CCCAGAAGGTGTCACCACAGAGG - Intronic
1018920620 6:168169876-168169898 CAAAGAAGGAGGGACCAGGGTGG - Intergenic
1019008833 6:168825676-168825698 CACAGAGGGCGGTACCTGAGAGG - Intergenic
1020274890 7:6617848-6617870 CAGAGAAGGTTTGCCCAGAGTGG - Intronic
1020287731 7:6698207-6698229 CTGAGAAGGAGTGACCAGGGAGG - Intronic
1021263069 7:18482813-18482835 CAAAGTGGGCATGACCAGAGAGG - Intronic
1022145759 7:27538830-27538852 CACTGAAGGCAGGAACAGAGAGG + Intronic
1022234620 7:28448835-28448857 CATAGAAGCCGAGCCCAGAGGGG + Intronic
1023247662 7:38222800-38222822 CAGAGAAGGAGTGGTCAGAGTGG + Intronic
1024123123 7:46265180-46265202 GAGTGAAGGGGTGACCAGAGTGG + Intergenic
1028970527 7:96853594-96853616 CACAGAAGAAGAGACCAGAGAGG - Intergenic
1030182092 7:106720857-106720879 CAAAGAAGGTATGGCCAGAGAGG + Intergenic
1031972346 7:128073914-128073936 CGCAGAAGGAGTGGCCAGAAGGG - Intronic
1032219314 7:129982043-129982065 CAGAGAAGGCATGAGGAGAGGGG + Intergenic
1032304600 7:130720816-130720838 CGAAGAAGGCATGACCAGTGAGG - Intergenic
1032502247 7:132408924-132408946 CACAGAATGTGAGAGCAGAGTGG - Intronic
1033322428 7:140352120-140352142 CACAGACGCCGTCACCAGAAAGG + Exonic
1037455287 8:19057441-19057463 CACAGAAGGCGTGACCAGAGTGG - Intronic
1037646531 8:20797283-20797305 CACAGCAGGCTTGACCAGCCTGG - Intergenic
1037825554 8:22158480-22158502 CACAGAAGGGGTGGCCACCGTGG + Intronic
1039251495 8:35670082-35670104 TAGAGAAGGAGTGGCCAGAGTGG + Intronic
1043159542 8:76828681-76828703 CACAAAAGGCATGGCTAGAGGGG + Intronic
1046884290 8:119346527-119346549 CACAGAAGGCATTTCCAGAAAGG + Intergenic
1050312963 9:4371936-4371958 CAGAGAAGGGGTGAGCAGACAGG - Intergenic
1050750587 9:8932555-8932577 CAGAGATGGCCTGCCCAGAGAGG + Intronic
1050973891 9:11912094-11912116 CAGAGATGGCCTGCCCAGAGGGG + Intergenic
1052146868 9:25060994-25061016 CAGAGATGGCTTGCCCAGAGAGG + Intergenic
1055987833 9:82070139-82070161 CACAGAAGCAGAGAGCAGAGTGG - Intergenic
1056708497 9:88971347-88971369 CACAGAAGGGGCGGCCACAGTGG - Intergenic
1062287072 9:135778048-135778070 GACAGAAGGAGTGACAAGGGAGG - Intronic
1062460964 9:136662427-136662449 CACAGGAGCCTTGACCAGTGAGG - Intronic
1186599773 X:11024477-11024499 CAGAGATGCCCTGACCAGAGAGG + Intergenic
1186871744 X:13780804-13780826 CTCAGAAGGCGCGCCCACAGAGG + Intronic
1187802592 X:23080687-23080709 CAAAGAAGCAGTGGCCAGAGAGG - Intergenic
1188605089 X:32018369-32018391 CAGCCAAGGAGTGACCAGAGTGG - Intronic
1191135375 X:57058606-57058628 CAGAGATGGCTTGCCCAGAGAGG + Intergenic
1191848568 X:65569003-65569025 CACAGATGCCCTGCCCAGAGAGG + Intergenic
1192533215 X:71907494-71907516 GACAGAAGGAGTAGCCAGAGAGG - Intergenic
1192712583 X:73607165-73607187 CAGAGATGGCCTGCCCAGAGAGG + Intronic
1193830849 X:86288294-86288316 CACAGAAGTGGTGGCCATAGAGG - Intronic
1196647492 X:118133498-118133520 CAGAGAAGGAGTAGCCAGAGAGG - Intergenic
1201886422 Y:18888570-18888592 CACAGAAGAAATTACCAGAGAGG - Intergenic
1202330641 Y:23749016-23749038 CAGAGATGCCCTGACCAGAGAGG - Intergenic
1202347939 Y:23954723-23954745 CAGAGATGACCTGACCAGAGAGG - Intergenic
1202522835 Y:25715381-25715403 CAGAGATGACCTGACCAGAGAGG + Intergenic
1202540128 Y:25921045-25921067 CAGAGATGCCCTGACCAGAGAGG + Intergenic