ID: 1037456088

View in Genome Browser
Species Human (GRCh38)
Location 8:19065679-19065701
Sequence AAGAGTGGCATGCCTGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037456088_1037456092 -7 Left 1037456088 8:19065679-19065701 CCTTACACAGGCATGCCACTCTT 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1037456092 8:19065695-19065717 CACTCTTCAGGAACCTCCATGGG No data
1037456088_1037456091 -8 Left 1037456088 8:19065679-19065701 CCTTACACAGGCATGCCACTCTT 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1037456091 8:19065694-19065716 CCACTCTTCAGGAACCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037456088 Original CRISPR AAGAGTGGCATGCCTGTGTA AGG (reversed) Intronic
900467217 1:2831628-2831650 AAGAGTGGAATGCATGAGTGTGG + Intergenic
900767568 1:4515337-4515359 ATGAGTGGCATGTTTGTGAATGG + Intergenic
901665852 1:10825814-10825836 CAGAGGGGCATGGCTGTGGAGGG - Intergenic
904117317 1:28172304-28172326 AACAGAGGCATGGCTGTGTGCGG - Intronic
905540282 1:38755251-38755273 AAGAGCGGCAGGCGTGGGTATGG + Intergenic
907087593 1:51691053-51691075 AAAAATGGTATGCCTGTATAGGG + Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
909281214 1:73756094-73756116 GAGAGTGACATGCCTGGGGACGG - Intergenic
910660676 1:89668697-89668719 AAGATTGGAAAGCCTGTGAAGGG - Intronic
911327541 1:96486467-96486489 AAAAATGGCATGCTTGTATAGGG - Intergenic
912371324 1:109176441-109176463 AAGTTTGGCATGTCTTTGTAGGG - Intronic
912609925 1:111032682-111032704 AAGAATGGCATGTCCATGTATGG - Intergenic
913663966 1:121030605-121030627 AAGAGTGGAAAGAGTGTGTAGGG + Intergenic
914015359 1:143813884-143813906 AAGAGTGGAAAGAGTGTGTAGGG + Intergenic
914162427 1:145147124-145147146 AAGAGTGGAAAGAGTGTGTAGGG - Intergenic
914653977 1:149722425-149722447 AAGAGTGGAAAGAGTGTGTAGGG + Intergenic
915047267 1:153028759-153028781 AAGAGCCACATGACTGTGTATGG + Intergenic
918531698 1:185529759-185529781 AAAAGTGGCACACCTGTATAGGG - Intergenic
919030747 1:192238715-192238737 AAGTGTAGAATGCCTGTGGACGG - Intergenic
919178958 1:194057426-194057448 AAGAGTAGGATGCCAGTGTCAGG - Intergenic
919967861 1:202546809-202546831 AAGAGTGGTAAGCTTGTCTAAGG + Intronic
923375685 1:233359672-233359694 AACGGTGGCATGCCTCTGTGTGG - Intronic
1065318718 10:24488900-24488922 AAGAAAGGCATGCCTGGGAAAGG + Intronic
1066145724 10:32555613-32555635 AAGAGTAGCATGCATATATAGGG + Intronic
1067732852 10:48824934-48824956 AAAAGTGACATGGCTGGGTATGG - Intronic
1068404039 10:56567435-56567457 AAAAATGGCATACCTGTATATGG + Intergenic
1068546389 10:58351033-58351055 AAAAATGGTATGCCTGTATAGGG + Intronic
1068638235 10:59371473-59371495 AAAAATGGCATACCTGTATAGGG + Intergenic
1068756134 10:60655808-60655830 AACAGTGGTACACCTGTGTAGGG - Intronic
1068784495 10:60956270-60956292 AAAAATGGTATGCCTGTATAGGG + Intronic
1071332941 10:84578744-84578766 AAAAATGGCACACCTGTGTAGGG - Intergenic
1071857212 10:89637575-89637597 AAACGTGGCATACCTGTATAGGG + Intronic
1075498179 10:122946301-122946323 AAAAATGGCACGCCTGTATAGGG - Intronic
1076505039 10:130966291-130966313 ATGAGTGGCATGCCAGTTTTGGG + Intergenic
1078619218 11:12892296-12892318 AAGAGGGGGATGGCTGTGCATGG + Intronic
1080724844 11:34886654-34886676 AAAAGTGGCACACCTGTCTAAGG - Intronic
1080922372 11:36721909-36721931 ATGAGTGGCATGTCTATGTCAGG - Intergenic
1081329319 11:41784893-41784915 GAGAGTGGCATGTCTGGGGAGGG + Intergenic
1083052261 11:59787870-59787892 AAGAGTGGAATGACAGTGTCAGG - Intronic
1083260641 11:61520991-61521013 AACAGTGGCCTGCCTCTGTGTGG + Intronic
1084538786 11:69774325-69774347 CAGATTAGCTTGCCTGTGTAGGG + Intronic
1086053884 11:82625979-82626001 ATGAGTGGCATACCTAAGTAAGG + Intergenic
1086856658 11:91873816-91873838 AAGACTGGCCTGCCTGAGGAAGG - Intergenic
1088738629 11:112748929-112748951 GAGAGTGGCAGGGCTGTGCATGG + Intergenic
1092351347 12:7758473-7758495 AAAATTTGCATGTCTGTGTAGGG - Intergenic
1095499848 12:42825469-42825491 AAGAGTGGCATTGCTGGGGATGG + Intergenic
1098321031 12:69243637-69243659 AAAAGTGGCACACTTGTGTAGGG + Intronic
1101772577 12:107765055-107765077 AAAAATGGTATGCCTGTATAGGG + Intergenic
1102220554 12:111191614-111191636 AACAGTGGCAGGGCTGGGTATGG - Intronic
1102458316 12:113084683-113084705 AAGAGAGACATGCCTGTAAATGG - Intronic
1103832721 12:123793148-123793170 CAGAGTGGCCTGGCTGTGCAAGG + Intronic
1104329532 12:127831548-127831570 AAAAGTGTCATCCCTGTATAGGG + Intergenic
1105468145 13:20666517-20666539 AAGAGTAGCATGCGAGTTTATGG + Intronic
1106000740 13:25720609-25720631 CAGAGTTGCCTTCCTGTGTAAGG - Intronic
1106059347 13:26271857-26271879 AAAATTGGTATACCTGTGTAGGG + Intronic
1106428814 13:29659460-29659482 AAAAGTGGGATGACTGAGTAAGG - Intergenic
1107080221 13:36366936-36366958 AAGAATGGCATGTCTATGTGTGG - Intronic
1107268841 13:38590482-38590504 AAAAATGGCACACCTGTGTAGGG - Intergenic
1108088032 13:46816585-46816607 AAGAGTGGCATGGGTGAGGAGGG - Intergenic
1108363423 13:49688041-49688063 AAGATATGAATGCCTGTGTATGG - Intronic
1108423616 13:50275792-50275814 AAAAATGGCATGCTTGTATAAGG + Intronic
1109974144 13:69808451-69808473 CAGAGTGCCAGGCCTCTGTAGGG - Intronic
1110719977 13:78750274-78750296 AAAAATGGCACACCTGTGTAGGG + Intergenic
1111345421 13:86946970-86946992 AAGAGTGGGCTGCCTGTGAACGG + Intergenic
1117117261 14:52526961-52526983 AAGGGTGGCATGCCAGCGGAGGG + Intronic
1119754441 14:77105082-77105104 AAAAGTAGCATGCATGTATAGGG + Intronic
1124021172 15:25925345-25925367 GAGAGTGGCATGCCCATGGAGGG + Intergenic
1124849084 15:33318537-33318559 GAGAGGGGCAAGCCTGAGTAGGG + Intronic
1127191475 15:56535659-56535681 AAAAATGGCACGCCTGTATAGGG - Intergenic
1131036785 15:89227616-89227638 AAGAGAGGCCTGCCTGTGTCAGG + Intergenic
1131601960 15:93858579-93858601 AAAAATGGCATACTTGTGTAGGG + Intergenic
1132411099 15:101578759-101578781 AACAGTGTCATGCCTGTGGGAGG - Intergenic
1134036459 16:11034976-11034998 AACAGGGGCATGCATGTGAAAGG - Intronic
1134038014 16:11046651-11046673 ATGAATGGCATGTCTGTCTAGGG - Intronic
1134308858 16:13058079-13058101 AAGATTGGCATGCTTGTATGTGG - Intronic
1136358753 16:29763964-29763986 ATGAGTGGCATGCGTGTGGCAGG - Intergenic
1139435616 16:66934988-66935010 AAGAATGGCGTGACTGAGTAGGG + Exonic
1139438006 16:66948035-66948057 AAGAATGGCGTGACTGAGTAGGG + Intergenic
1139841524 16:69885065-69885087 AAGAGTGGTGTGTGTGTGTAGGG - Intronic
1140895144 16:79317997-79318019 AACAGTGTCATGCCTTTGTTTGG + Intergenic
1143677261 17:8443506-8443528 TAGAGTGGGATGCCTGGGGAGGG + Intronic
1144296289 17:13878145-13878167 AAGAGTACCAAGCCTTTGTAAGG - Intergenic
1146340875 17:32018904-32018926 AAAAATGGTATGCCTGTGTAGGG - Intronic
1149991992 17:61388451-61388473 GACAGTGACATGCATGTGTAGGG - Intronic
1152480103 17:80545223-80545245 AAGAGCGGCCTGCCTGTCTTCGG + Intronic
1153231606 18:2942228-2942250 ATGAGTGGTATGCCAGAGTAAGG - Intronic
1155642457 18:28035231-28035253 TGGAGTGGAATGTCTGTGTATGG - Intronic
1157857227 18:51114219-51114241 ACCAGTGGCATACCTATGTAAGG - Intergenic
1159391666 18:67801323-67801345 AAAAATGGCATGCCTGTGTAAGG + Intergenic
1159488911 18:69103663-69103685 ACGTGTGACATGCCTGTGGAAGG - Intergenic
1160351814 18:78189035-78189057 AAGAGCGGCATTCCTCTGTAAGG - Intergenic
1161113824 19:2485619-2485641 AAGAGAGGCATCTGTGTGTATGG + Intergenic
1166558999 19:43719642-43719664 GAGAGGGGCATCCCTGTGTTTGG + Exonic
1168439382 19:56350926-56350948 AAGAATGGCATGTCTGTGTGTGG - Intronic
926178958 2:10623178-10623200 TAGAGTGGCATGCCTTTGAAGGG - Intronic
928320715 2:30280997-30281019 AATAGTCCCATGCCTGTGGAGGG - Intronic
928773971 2:34736701-34736723 AAGAATAGCATGCCCTTGTAAGG + Intergenic
930309633 2:49723609-49723631 AAGTGTCACATGCCTGTATATGG - Intergenic
930336098 2:50047678-50047700 AAGAGGGGGATGCCTGTGTGTGG - Intronic
931738021 2:65215737-65215759 AAGAGTGGCATACCTTTGGCAGG - Intergenic
933174986 2:79164926-79164948 AACTGTGGCATACCTGAGTAAGG - Intergenic
935329573 2:101966933-101966955 AACAGTGTCTTACCTGTGTATGG + Intergenic
935400461 2:102654946-102654968 AAAAGTGGTATACCTGTATAAGG + Intronic
935748958 2:106213561-106213583 AACCGTGGCATACCTGAGTAAGG + Intergenic
935791533 2:106595384-106595406 AAGAGAGGAAAGCTTGTGTAGGG + Intergenic
936174745 2:110209983-110210005 GAGAGGGGCATGACTGTGTCAGG + Intergenic
937686098 2:124698919-124698941 AAGAGTGGCAGCCCAGTGTGAGG + Intronic
938115815 2:128602424-128602446 GAGGGTGGCATGCCTGTGTCAGG + Intergenic
939789639 2:146555810-146555832 AGGAGTGGCTTAGCTGTGTAAGG - Intergenic
941074937 2:160996314-160996336 AAAAGTGGTATACCTGTATAAGG - Intergenic
942308050 2:174627993-174628015 AAGAGTGGCATTCTTGGGGAGGG + Intronic
943705518 2:191029557-191029579 AAGACTCGCTTGCCTGTGTTTGG - Intronic
945275656 2:207985106-207985128 AAGAGTGGCAGCACTGTGTGAGG - Intronic
946937142 2:224734070-224734092 GAGAGTGGCATGCCTGGGAAGGG - Intergenic
947699118 2:232217757-232217779 GAGGGTGGCATGCCTGGGGAAGG - Intronic
948564065 2:238872310-238872332 ATGAGGGCCATGCCAGTGTAGGG + Intronic
1173061373 20:39664836-39664858 GAGAGTGGCATGCCTAGGGAGGG + Intergenic
1176938136 21:14890239-14890261 AAGCAAGGCATGCCTATGTATGG - Intergenic
1176977754 21:15342584-15342606 AAGAGTAGCATGACCTTGTAGGG + Intergenic
1179386685 21:40950029-40950051 AAGAGTGGCATTCATTTCTAAGG - Intergenic
1179554356 21:42162946-42162968 AAGACTCGCATGGCTGTGCAGGG + Intergenic
1180129057 21:45814198-45814220 AAGAATGGCACACCTGGGTAGGG + Intronic
950405662 3:12802950-12802972 TAAAATGGCATGCCTGTATAGGG + Intronic
950965356 3:17142241-17142263 ACTAGTGGCATGCCGGTGTGTGG - Intergenic
951715044 3:25633387-25633409 GAGGGTGGCATGTCTGGGTAAGG - Intronic
952276587 3:31883223-31883245 AAGAGTGGCATGCTTGTCAAAGG - Intronic
952975402 3:38690455-38690477 AAAAATGGTATGCCTTTGTAAGG - Intergenic
954116569 3:48469903-48469925 AAGAGGGGCATGCCTTGGGAAGG - Intronic
958152265 3:89705460-89705482 AAGAGATGCAAGCTTGTGTAGGG + Intergenic
958548907 3:95590848-95590870 ACCAGTGGCATACCTGAGTAAGG - Intergenic
958693592 3:97499740-97499762 AAAAGTGCCCTACCTGTGTAGGG + Intronic
959740187 3:109709876-109709898 AATAGTGGCATGTTTGTCTATGG - Intergenic
960240157 3:115331361-115331383 GAGAGTGGCATGGCTGGGGAGGG + Intergenic
961702038 3:128751937-128751959 AAGAGAGGAATGCTTGTGCAGGG - Intronic
965300084 3:166997761-166997783 AAGGGTAGCCTGCCTGTGTCCGG - Intergenic
967749159 3:193094161-193094183 CAGAGTAGCATGCTTTTGTATGG + Intergenic
969930758 4:10628661-10628683 AAGACTGCGATGCCTGTGTTGGG + Intronic
972452654 4:39218508-39218530 TAAAATGGCATGCCTGTATAGGG + Intronic
974729125 4:65838354-65838376 GAGAGTGGCATGCCTGGAGAGGG + Intergenic
976549798 4:86381221-86381243 AGGGGAGGCATGCATGTGTAAGG - Intronic
978064684 4:104382247-104382269 AAGTGTGGCTTGCGTGTGTCAGG + Intergenic
981564771 4:146088344-146088366 AAGTGAGGTATGCCTGTATATGG + Intergenic
981943209 4:150309076-150309098 AAAACTGGCATACCTGTATAGGG - Intronic
982223545 4:153145104-153145126 AGGAGTGGAATGGCTGGGTATGG + Intergenic
986403734 5:7405204-7405226 AAGTTTGGCATGGCTATGTAAGG - Intronic
988831483 5:34991738-34991760 AAGAATGGTATACCTGTTTAGGG - Intergenic
992823844 5:80527673-80527695 AAAAATGGCACACCTGTGTAGGG + Intronic
992950244 5:81851246-81851268 AAGAGTTGCATTCCTTTGCAAGG - Intergenic
993137435 5:83987355-83987377 AAAAGTGGCATGCCTTCATATGG + Intronic
993755966 5:91730369-91730391 CAGAATGCCAAGCCTGTGTATGG + Intergenic
994454324 5:99985263-99985285 AACAGTGGCATACCTAAGTAAGG + Intergenic
998216133 5:140239814-140239836 AAGAGAGGCAAGCCAGTGCAGGG + Intronic
998489696 5:142535891-142535913 AAAAGTGGTTTGCCTGTATAGGG + Intergenic
999781103 5:154851066-154851088 AGGAAAGGCATGCCTGTGGAGGG + Intronic
1002865945 6:1122434-1122456 AAGAATGTCATGCCAGAGTAAGG + Intergenic
1005102853 6:22191985-22192007 GAGAATGGCATCCCTGTGAAGGG + Intergenic
1006600326 6:35221131-35221153 AGCAGTGGAATGCCTGTGTCAGG + Intronic
1007147133 6:39647375-39647397 AAGAGGGGCAGGCAGGTGTATGG + Intronic
1007923997 6:45636467-45636489 AACAGTGGCTTGCCTAAGTAGGG + Intronic
1008561979 6:52732777-52732799 AAGTGTGGAATGGCTTTGTATGG - Intergenic
1012048202 6:94305504-94305526 AAGAGTGGAATGGCTGGGTCAGG - Intergenic
1013545474 6:111152884-111152906 AAGAGGGAAATGCATGTGTAAGG + Intronic
1014729481 6:125015488-125015510 AATAGTAGGATGCCTGTATATGG + Intronic
1016572433 6:145530211-145530233 TACAGTGGGATGCCTGTGGAGGG + Intronic
1017622945 6:156317693-156317715 ATGAGTGGGATGCCAGTGGAGGG - Intergenic
1020040487 7:4997386-4997408 AAGAGTGGGATGCCTCTGCTGGG + Intronic
1022527862 7:31049935-31049957 CACAGTGGCATGCCTGTGACAGG + Intergenic
1022916362 7:34958379-34958401 TAGATTGGCTTGCATGTGTATGG - Intronic
1023919781 7:44619089-44619111 GAGGGTGGCATGCCTGGGGAGGG + Intronic
1028516481 7:91682761-91682783 GAGAGTGGCAAGCCTGGGGAGGG + Intergenic
1028741019 7:94275529-94275551 AAGTGTGGCATGCCAATGCATGG - Intergenic
1031432706 7:121692336-121692358 AAAAGTGGCATACCTGTATAGGG - Intergenic
1032071872 7:128812844-128812866 AAGAGCTGGATGCCTGTGAAAGG + Exonic
1034057495 7:148050743-148050765 AAGAATGGCACACCTGTATAGGG - Intronic
1035064056 7:156092515-156092537 AACAGTGGGACGCCTGTGTGGGG + Intergenic
1037321858 8:17651168-17651190 AGGAGAGGTATGCGTGTGTATGG + Intronic
1037456088 8:19065679-19065701 AAGAGTGGCATGCCTGTGTAAGG - Intronic
1037700956 8:21273412-21273434 AAAATTGGGATGCCTGGGTAAGG - Intergenic
1040597547 8:48854158-48854180 AAGAATGGAACACCTGTGTAGGG - Intergenic
1040964763 8:53072453-53072475 AACAGTGGCATACCTAAGTAAGG - Intergenic
1041069836 8:54116944-54116966 AAAAATGGTATACCTGTGTAGGG + Intergenic
1041482978 8:58343621-58343643 AAGTGTGGCATTCTTGTCTAGGG - Intergenic
1042919911 8:73910644-73910666 ACCAGTGGCATGCCTAAGTAAGG + Intergenic
1043491896 8:80757685-80757707 AAAAATGGTATACCTGTGTAGGG - Intronic
1045234940 8:100343310-100343332 ATGAGTGGCATGACAGTGTCAGG - Intronic
1045421059 8:102015699-102015721 AAGAGTGGCATGCCCTTCCAAGG + Intronic
1048502569 8:134992127-134992149 AAAAGTGGCATGACTGTGTCTGG + Intergenic
1048644048 8:136398062-136398084 ACAAGTGGCATGAATGTGTAAGG + Intergenic
1049563092 8:143322444-143322466 CTGTGTGGCATGCCTGTGTGTGG - Intronic
1052168867 9:25368952-25368974 AAAAATGGCATACCTATGTAGGG + Intergenic
1052457229 9:28715722-28715744 AAAAGTGGCTTGTCTATGTAAGG - Intergenic
1054481636 9:65670941-65670963 AAGAGTTGCCTGCCTGTGGTTGG + Intronic
1054869883 9:70039469-70039491 AGGAGAGACAGGCCTGTGTAAGG + Intergenic
1055462896 9:76536164-76536186 ATGAGTTGCATGGGTGTGTAAGG + Intergenic
1055850829 9:80628009-80628031 AAGAATGACAAGACTGTGTAGGG + Intergenic
1056644261 9:88396962-88396984 AGAAATGGCATGCCTGTGTAGGG + Intronic
1058662424 9:107279034-107279056 AAAAATGGCACACCTGTGTAGGG - Intergenic
1059184171 9:112251177-112251199 AAGAGTGGCAATCAGGTGTAAGG + Intronic
1059872313 9:118591609-118591631 AAAAGTGGTATACCTGTATAGGG - Intergenic
1060241762 9:121909869-121909891 AAGAGAGGAATGCCTGGGAAAGG + Intronic
1061741521 9:132709777-132709799 AAGAGGGACATGCCTGAGAAGGG - Intergenic
1062706681 9:137948946-137948968 CTGTGTGGCATGCATGTGTATGG + Intronic
1186283070 X:8014967-8014989 AATATTGACATGCATGTGTATGG - Intergenic
1189266630 X:39721724-39721746 AAGTGTGGCATGCGTTTGGAAGG - Intergenic
1189709521 X:43795355-43795377 GAGAATGGCATGCCTGGGGAGGG - Intronic
1194012778 X:88583081-88583103 AAGTGTGGCATGTCTGTGCAAGG + Intergenic
1194250206 X:91564943-91564965 GAGGGTAGCATGCCTGGGTAGGG - Intergenic
1194819777 X:98491210-98491232 GAGAGTGGCATGCCTGGAGAGGG + Intergenic
1195409430 X:104553847-104553869 AAGAGTTGCTTGCCTCTCTAAGG + Intergenic
1198039680 X:132837634-132837656 AAGAATGGCTTGCCTGGATATGG - Intronic
1199730124 X:150623503-150623525 AAGAGTGGCAGGCATGTTGAGGG + Intronic
1200569168 Y:4806192-4806214 GAGGGTAGCATGCCTGGGTAGGG - Intergenic
1201631523 Y:16075899-16075921 ACCAGTGGCATGCCTAAGTAAGG + Intergenic
1201981035 Y:19910655-19910677 AAGAGTGGGATGACTGTGTTTGG - Intergenic