ID: 1037456329

View in Genome Browser
Species Human (GRCh38)
Location 8:19067922-19067944
Sequence TACCCACAAGGGTCCCACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037456329_1037456335 11 Left 1037456329 8:19067922-19067944 CCAACGTGGGACCCTTGTGGGTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1037456335 8:19067956-19067978 CCCTCCATCAGTCAGGCACATGG No data
1037456329_1037456337 12 Left 1037456329 8:19067922-19067944 CCAACGTGGGACCCTTGTGGGTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1037456337 8:19067957-19067979 CCTCCATCAGTCAGGCACATGGG No data
1037456329_1037456333 4 Left 1037456329 8:19067922-19067944 CCAACGTGGGACCCTTGTGGGTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1037456333 8:19067949-19067971 GGAAAATCCCTCCATCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037456329 Original CRISPR TACCCACAAGGGTCCCACGT TGG (reversed) Intronic
904487164 1:30833600-30833622 GACCCACAGAGGTCCCACGCTGG - Intergenic
916652711 1:166846103-166846125 AACCCACAAAGATCCCACGGAGG + Intronic
924043775 1:240008681-240008703 CACACACACGGGGCCCACGTGGG - Intergenic
1067237302 10:44461742-44461764 TTTCCTCAAGGGTGCCACGTAGG + Intergenic
1067572143 10:47379503-47379525 GACCCTCCAGGGTCCCAGGTGGG - Intronic
1073311932 10:102549118-102549140 TGCCCACAAGGGTACAACCTTGG - Intronic
1074735275 10:116424819-116424841 TTGCAACAAGGGTCCCATGTAGG - Intergenic
1076098651 10:127755621-127755643 TATCCATAAGGGTCCCACACTGG - Intergenic
1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG + Intergenic
1078542554 11:12223510-12223532 CACCCACCAGGGTCCCAGGAGGG - Intronic
1084877787 11:72146345-72146367 TGGCCACAAGGGTCCCACCAAGG + Intergenic
1090267409 11:125361972-125361994 TTCCCACATGGGTTCCACATGGG + Intronic
1101252300 12:102948362-102948384 TACCCAAAAGAGCCCCACTTTGG - Intronic
1102454101 12:113060947-113060969 TCCCCACAAGGCTGCCAAGTTGG + Intronic
1103887627 12:124214744-124214766 TACCCACATGCGTCCCATGTAGG + Intronic
1115543151 14:34441691-34441713 TACCCACATGGGTCCTGGGTGGG - Intronic
1118443432 14:65831554-65831576 TACCCTCAAGGGACCCGCCTGGG + Intergenic
1122370253 14:101225581-101225603 TCCCCACAAGGGCCCCCCGGGGG + Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1122996334 14:105267228-105267250 CACCGACAAGGGGCCCACATGGG + Intronic
1130990551 15:88873335-88873357 TACCCACAAGGGCCCCCAGATGG + Intronic
1138616262 16:58169669-58169691 TGTACATAAGGGTCCCACGTGGG + Intronic
1147374835 17:40017254-40017276 TACTCTCAAGGGTCCCAGGTGGG - Exonic
1152414699 17:80151956-80151978 TTCCCACATGGTTTCCACGTTGG + Intergenic
1162832120 19:13291817-13291839 TACCCCCAATGGGCCCAAGTTGG - Intronic
1166624281 19:44335720-44335742 TACTCTCAAGGGTACCATGTAGG + Intronic
1167717691 19:51154414-51154436 TACCTCCTAGGGTCCCACATGGG - Intergenic
931557211 2:63518783-63518805 ACCCCACTAGGGTACCACGTGGG + Intronic
935520261 2:104095770-104095792 AACCCACAAGCTTCCAACGTGGG + Intergenic
947871708 2:233442248-233442270 TGCCCACAAAGGACCCACATGGG + Intronic
1168768371 20:397441-397463 TCCCCAGAAGAGTCCCACCTGGG - Exonic
1172608740 20:36233385-36233407 TTCCCACTAGGCTCCCATGTAGG - Intergenic
1182936352 22:34225916-34225938 TGCCCTCAAGGGCCCCAAGTGGG - Intergenic
1184471305 22:44697831-44697853 TCCCCACAAGGCTGCCAAGTGGG - Intronic
1184519949 22:44987528-44987550 AACTAACAAGGGTCCAACGTGGG + Intronic
1184723504 22:46329643-46329665 CACTCTCAAGGGTCCCACGATGG - Intronic
951538649 3:23762029-23762051 AACTCACAAGGGTCCCACATAGG + Intergenic
953997862 3:47534591-47534613 TTCCACCAAGGGTCCCAAGTTGG - Intergenic
954133437 3:48571213-48571235 TACCCAGAAGGGTCCCTGCTGGG - Intronic
955750462 3:62181206-62181228 TCCGCACCAGGGTCCCACATCGG + Intronic
962519680 3:136186675-136186697 TTTCCACAAGGGTCCCATCTGGG - Intronic
968062084 3:195733323-195733345 TACCCAGAAGGTTCCCATGAAGG + Exonic
980080054 4:128334657-128334679 TCCCCACAAGTTTCCCATGTGGG - Intergenic
986744027 5:10728777-10728799 TTGACACAAGGGTGCCACGTAGG - Intronic
1007356225 6:41319644-41319666 AGCCCACAAGGGTCCCAGGAGGG + Intergenic
1007739025 6:44000008-44000030 TACCCACATGTGCCCCAGGTGGG - Intergenic
1008195255 6:48511304-48511326 TTCCCACAAGGGTACCACAAGGG + Intergenic
1018583000 6:165323985-165324007 TATCCCCAAGGTTCCCACCTTGG + Intergenic
1022799027 7:33757465-33757487 TACCCACAATGGTTATACGTTGG + Intergenic
1024599189 7:50964554-50964576 TCCCACCAAGGGTCCCAAGTTGG - Intergenic
1035368154 7:158361743-158361765 TACCAACAAGGGCCCCAGGAAGG + Intronic
1037456329 8:19067922-19067944 TACCCACAAGGGTCCCACGTTGG - Intronic
1056966677 9:91168336-91168358 CACCCACAAGGGACACACCTTGG + Intergenic
1059391469 9:114002134-114002156 CACCCACGAGGGGCCCAAGTGGG - Intronic
1190106617 X:47565333-47565355 AACCCCCCAGGGTCCCAGGTAGG + Exonic
1192055179 X:67766543-67766565 TACGTACAAGGGTCCCAAGGTGG - Intergenic