ID: 1037456912

View in Genome Browser
Species Human (GRCh38)
Location 8:19072932-19072954
Sequence CATCCTTTATAGTTGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037456912_1037456920 16 Left 1037456912 8:19072932-19072954 CCTTGGCCCAACTATAAAGGATG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1037456920 8:19072971-19072993 TCCGAGACTGAATTTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037456912 Original CRISPR CATCCTTTATAGTTGGGCCA AGG (reversed) Intronic
904260335 1:29284195-29284217 GAGCCATTATAGTTGGGCCTTGG + Intronic
907841392 1:58161038-58161060 CATCTTTTCTAGATGGGCAATGG - Intronic
917269008 1:173252968-173252990 AATCTTTTATAGTTTGACCATGG - Intergenic
918385399 1:184002214-184002236 CTTCGTTTATTGTTGGGCCCAGG - Intronic
918489523 1:185066160-185066182 CATCCTTTACTGTTGGCCAAAGG + Intronic
923348719 1:233082569-233082591 CTTCCTTTAAAGTTATGCCAGGG - Intronic
1063625906 10:7689696-7689718 TATCCATTTTTGTTGGGCCAAGG - Intergenic
1064412947 10:15123783-15123805 CATGCATATTAGTTGGGCCATGG - Intronic
1067834148 10:49627846-49627868 CCTCCTCTAGGGTTGGGCCAGGG + Intronic
1068948769 10:62756459-62756481 CATCCTTTAAAATGGGGACAAGG + Intergenic
1073865917 10:107803520-107803542 TATCCTTTATATTTGGGTCAAGG - Intergenic
1076922673 10:133463064-133463086 AATCCTTTAAAGCTGTGCCATGG - Intergenic
1079990384 11:27240383-27240405 CATGGTTTATATTTGGCCCATGG + Intergenic
1080578791 11:33624080-33624102 CAGCTTTTAAAGTTGGGCTATGG + Intronic
1083874539 11:65514394-65514416 CATTGTTTATAGTTGTTCCAAGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1092015039 12:5151552-5151574 CATCTATCAAAGTTGGGCCAGGG + Intergenic
1095844912 12:46734058-46734080 CCTGCTTTATATTTTGGCCATGG + Intergenic
1097112188 12:56668900-56668922 AATCATTTATTCTTGGGCCATGG + Intronic
1097533455 12:60835599-60835621 GCTCCTTTATTGTTGGGCAAAGG - Intergenic
1099978399 12:89570478-89570500 TATCCTCTATGGTTGGCCCAAGG - Intergenic
1116123394 14:40750473-40750495 CTTTCCTTATAGTTGGCCCATGG + Intergenic
1117084684 14:52187537-52187559 CATCCTTTACAGATGTCCCATGG - Intergenic
1119887422 14:78154568-78154590 AAACCTTTATAGTTGGGCTAAGG + Intergenic
1120959608 14:90112449-90112471 CATTGTTTTTAGTTGAGCCACGG - Intronic
1128590632 15:68893645-68893667 CACCCTTTGTAGTTGTCCCACGG + Intronic
1133595888 16:7291451-7291473 CAGCCTTAATAGTTGGGAGATGG + Intronic
1138816071 16:60204214-60204236 CATATTTTATAGTTGGGGAAGGG + Intergenic
1138860518 16:60750411-60750433 CATCCTATATAGTCAGGCTAAGG + Intergenic
1148032607 17:44631823-44631845 GATCCTTGATAGCTTGGCCAGGG + Intergenic
1149774162 17:59344200-59344222 CATCCTTTATAAAGGGGTCAAGG + Intronic
1149956421 17:61055726-61055748 CATGGTTTATAAATGGGCCAAGG + Intronic
1153940821 18:9975034-9975056 CATCCTTTGTAGTTGGGGGAAGG + Intergenic
1155998097 18:32353450-32353472 TAACCCTTATAGTTGGGCTAAGG - Intronic
1156067613 18:33163453-33163475 CATCATTTATACTAGGGCCATGG - Intronic
1202633636 1_KI270706v1_random:23083-23105 CATTCTTGTTACTTGGGCCAGGG + Intergenic
1202652248 1_KI270707v1_random:16971-16993 CATTCTTGTTACTTGGGCCAGGG - Intergenic
1202659894 1_KI270708v1_random:58759-58781 CATTCTTGTTACTTGGGCCAGGG + Intergenic
926606147 2:14900495-14900517 CATCCTTTATGGTTTGGTTATGG + Intergenic
929937709 2:46306334-46306356 CTTCCTTTATATTTGGGAAATGG + Intronic
945574566 2:211514602-211514624 CATCTTTTATAGTAGAGCCTAGG - Intronic
947247520 2:228066026-228066048 CATCCTTTATTCTGGGGGCAGGG + Intronic
1169578286 20:6990630-6990652 CGTCCTCTATACTTGGCCCATGG - Intergenic
1172572484 20:35981555-35981577 CCTCCTTTGTAGCTGGGACAAGG + Intronic
1176599903 21:8782683-8782705 CATTCTTGTTACTTGGGCCAGGG + Intergenic
1176645849 21:9348940-9348962 CATTCTTGTTACTTGGGCCAGGG + Intergenic
1179944971 21:44666951-44666973 CAGCCTTTATACCTGGGCCCAGG + Intronic
1180367078 22:11950213-11950235 CATTCTTGTTACTTGGGCCAGGG - Intergenic
1180379007 22:12121139-12121161 CATTCTTGTTACTTGGGCCAGGG + Intergenic
1180418521 22:12792178-12792200 CATTCTTGTTACTTGGGCCAGGG - Intergenic
1181108292 22:20587380-20587402 CATCCTTCACAGTGGGGACACGG - Exonic
1182983751 22:34697649-34697671 CTTCCTTTAAAGCTGAGCCATGG - Intergenic
953970182 3:47341405-47341427 CATCCAATGTGGTTGGGCCATGG + Intronic
954854191 3:53628434-53628456 CATCCTTTAGAATTGGGTTAGGG - Intronic
954977313 3:54708586-54708608 CCTCCTGCATACTTGGGCCAAGG - Intronic
958850320 3:99317282-99317304 AATCCTTTAGAGTTGGTTCATGG + Intergenic
961086465 3:124071872-124071894 CTTCCTATATAGTTGTGACATGG - Intergenic
961150126 3:124630935-124630957 CATCCTCTCTAATTAGGCCATGG + Intronic
963219995 3:142798613-142798635 TATCCTTTATAGTTGGACCGTGG + Intronic
963236110 3:142958425-142958447 AAAGCTTTATAGTTGGTCCAAGG - Intronic
1202741036 3_GL000221v1_random:56123-56145 CATTCTTGTTACTTGGGCCAGGG - Intergenic
971540629 4:27812008-27812030 CATCCTTTACTCTTGGGACAGGG + Intergenic
973363267 4:49185101-49185123 CATTCTTGTTACTTGGGCCAGGG + Intergenic
973397828 4:49611755-49611777 CATTCTTGTTACTTGGGCCAGGG - Intergenic
974649450 4:64735201-64735223 CCTGCTTTATAGTAGGGACAAGG - Intergenic
974952558 4:68600629-68600651 CAGCTTTTTTAGTTGGGCCCAGG - Intronic
976965071 4:91027965-91027987 CATCCATTATAGTTAGGACATGG + Intronic
978033532 4:103967391-103967413 CATCCTTTGTAGTTGTCTCATGG + Intergenic
978312796 4:107403939-107403961 CTTTATTTTTAGTTGGGCCAGGG - Intergenic
1202760625 4_GL000008v2_random:106618-106640 CATTCTTGTTACTTGGGCCAGGG + Intergenic
991172963 5:63649837-63649859 AATCTTTTATACTTTGGCCAAGG + Intergenic
991956908 5:72004274-72004296 TATCCTTTGTACTTGGGCCCAGG - Intergenic
992936305 5:81710186-81710208 CACCCATTATAATTGGACCATGG - Intronic
993935852 5:94001458-94001480 CATCATTTGTAGTTGCCCCATGG + Intronic
1001369015 5:171177493-171177515 TGTACTTTATACTTGGGCCAAGG + Intronic
1003215348 6:4104290-4104312 CATCTTTTCTAGTAGGGGCATGG - Intronic
1007677998 6:43614081-43614103 AATGCTTTACAGTTGGACCATGG - Exonic
1009403256 6:63281068-63281090 CAACCTTTAGAGTTTTGCCATGG - Exonic
1014493839 6:122094631-122094653 AAGCCTTTATGGTAGGGCCAGGG - Intergenic
1016032362 6:139351103-139351125 CAGCCTTTCTAGTAGGGGCAGGG - Intergenic
1020852426 7:13373378-13373400 CATCCTTGCTAGTAGGTCCAGGG + Intergenic
1021609846 7:22446255-22446277 GATCCTATAGATTTGGGCCAGGG + Intronic
1022984558 7:35638651-35638673 TATTCTATATAGTTGGGCCCTGG - Intronic
1023603752 7:41908344-41908366 AATCCTTTGAAGTAGGGCCAAGG - Intergenic
1025165637 7:56709885-56709907 CATCATTTATAGGTGGGCATGGG - Intergenic
1025735992 7:64147218-64147240 CATCATTTATAGGTGGGCATGGG + Intronic
1028037918 7:86008500-86008522 CATTTTTTATAGTTGGGTCAAGG + Intergenic
1031155876 7:118111507-118111529 CATCCTGTACAATTGGCCCAGGG + Intergenic
1037456912 8:19072932-19072954 CATCCTTTATAGTTGGGCCAAGG - Intronic
1045605384 8:103767928-103767950 TCTCCTTTATTGTTGGTCCAGGG + Intronic
1046502175 8:115092864-115092886 CACCTTTTGTAGTTGGCCCACGG + Intergenic
1048335646 8:133500255-133500277 CATCCATTATTGATGGGGCATGG - Intronic
1049245390 8:141559684-141559706 CACCCTTCATAGCTGAGCCAGGG + Intergenic
1050826427 9:9951946-9951968 CAACATATATATTTGGGCCAGGG - Intronic
1058729109 9:107832898-107832920 GTTTCTTTATAGTTGGGCAAGGG + Intergenic
1203709675 Un_KI270742v1:86053-86075 CATTCTTGTTACTTGGGCCAGGG - Intergenic
1203541395 Un_KI270743v1:91503-91525 CATTCTTGTTACTTGGGCCAGGG + Intergenic
1196292558 X:113960453-113960475 CATCCTTCATAGTTTGGCTAAGG - Intergenic
1198672944 X:139100874-139100896 CATTTCTTATACTTGGGCCATGG - Intronic
1202034012 Y:20612582-20612604 CTTCCAGTATAGTTGGGGCATGG - Intergenic