ID: 1037469381

View in Genome Browser
Species Human (GRCh38)
Location 8:19192549-19192571
Sequence AACATGAGACTTCGAGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037469380_1037469381 -4 Left 1037469380 8:19192530-19192552 CCTGTTTAATAATTAAAGCAACA No data
Right 1037469381 8:19192549-19192571 AACATGAGACTTCGAGTGAATGG No data
1037469379_1037469381 17 Left 1037469379 8:19192509-19192531 CCAAATGCTAAGGCTCTTCAGCC No data
Right 1037469381 8:19192549-19192571 AACATGAGACTTCGAGTGAATGG No data
1037469378_1037469381 18 Left 1037469378 8:19192508-19192530 CCCAAATGCTAAGGCTCTTCAGC No data
Right 1037469381 8:19192549-19192571 AACATGAGACTTCGAGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037469381 Original CRISPR AACATGAGACTTCGAGTGAA TGG Intergenic
No off target data available for this crispr