ID: 1037469627

View in Genome Browser
Species Human (GRCh38)
Location 8:19194680-19194702
Sequence ATAAAGAAGAAGAATGACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037469625_1037469627 -2 Left 1037469625 8:19194659-19194681 CCAAAAGTTTTAGTCATCAAGAT No data
Right 1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG No data
1037469624_1037469627 24 Left 1037469624 8:19194633-19194655 CCTTGGACACAAAATTTAAGGGC No data
Right 1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037469627 Original CRISPR ATAAAGAAGAAGAATGACGA GGG Intergenic
No off target data available for this crispr