ID: 1037476782

View in Genome Browser
Species Human (GRCh38)
Location 8:19265472-19265494
Sequence CTTCCTCCACGCCCTTCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037476782_1037476786 1 Left 1037476782 8:19265472-19265494 CCTCTTGAAGGGCGTGGAGGAAG No data
Right 1037476786 8:19265496-19265518 TGTCAGGTAAAGAGAGTTAAGGG No data
1037476782_1037476788 5 Left 1037476782 8:19265472-19265494 CCTCTTGAAGGGCGTGGAGGAAG No data
Right 1037476788 8:19265500-19265522 AGGTAAAGAGAGTTAAGGGGAGG No data
1037476782_1037476787 2 Left 1037476782 8:19265472-19265494 CCTCTTGAAGGGCGTGGAGGAAG No data
Right 1037476787 8:19265497-19265519 GTCAGGTAAAGAGAGTTAAGGGG No data
1037476782_1037476785 0 Left 1037476782 8:19265472-19265494 CCTCTTGAAGGGCGTGGAGGAAG No data
Right 1037476785 8:19265495-19265517 GTGTCAGGTAAAGAGAGTTAAGG No data
1037476782_1037476791 19 Left 1037476782 8:19265472-19265494 CCTCTTGAAGGGCGTGGAGGAAG No data
Right 1037476791 8:19265514-19265536 AAGGGGAGGCAGGGAACGATTGG No data
1037476782_1037476789 9 Left 1037476782 8:19265472-19265494 CCTCTTGAAGGGCGTGGAGGAAG No data
Right 1037476789 8:19265504-19265526 AAAGAGAGTTAAGGGGAGGCAGG No data
1037476782_1037476790 10 Left 1037476782 8:19265472-19265494 CCTCTTGAAGGGCGTGGAGGAAG No data
Right 1037476790 8:19265505-19265527 AAGAGAGTTAAGGGGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037476782 Original CRISPR CTTCCTCCACGCCCTTCAAG AGG (reversed) Intergenic
No off target data available for this crispr