ID: 1037477864

View in Genome Browser
Species Human (GRCh38)
Location 8:19275435-19275457
Sequence ACCCAGGCCTGCTCTATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037477864_1037477869 10 Left 1037477864 8:19275435-19275457 CCCTGCATAGAGCAGGCCTGGGT No data
Right 1037477869 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
1037477864_1037477872 25 Left 1037477864 8:19275435-19275457 CCCTGCATAGAGCAGGCCTGGGT No data
Right 1037477872 8:19275483-19275505 CTGCAGGGCTGCACTGGCTCTGG No data
1037477864_1037477870 19 Left 1037477864 8:19275435-19275457 CCCTGCATAGAGCAGGCCTGGGT No data
Right 1037477870 8:19275477-19275499 GTCAACCTGCAGGGCTGCACTGG No data
1037477864_1037477867 9 Left 1037477864 8:19275435-19275457 CCCTGCATAGAGCAGGCCTGGGT No data
Right 1037477867 8:19275467-19275489 ACCGCAGTGAGTCAACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037477864 Original CRISPR ACCCAGGCCTGCTCTATGCA GGG (reversed) Intergenic
No off target data available for this crispr