ID: 1037477866

View in Genome Browser
Species Human (GRCh38)
Location 8:19275451-19275473
Sequence CTGCGGTAAACTGTGTACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037477866_1037477878 27 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477878 8:19275501-19275523 TCTGGAGCAGGCTCAGGGGAGGG No data
1037477866_1037477874 21 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477874 8:19275495-19275517 ACTGGCTCTGGAGCAGGCTCAGG No data
1037477866_1037477877 26 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477877 8:19275500-19275522 CTCTGGAGCAGGCTCAGGGGAGG No data
1037477866_1037477869 -6 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477869 8:19275468-19275490 CCGCAGTGAGTCAACCTGCAGGG No data
1037477866_1037477876 23 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477876 8:19275497-19275519 TGGCTCTGGAGCAGGCTCAGGGG No data
1037477866_1037477875 22 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477875 8:19275496-19275518 CTGGCTCTGGAGCAGGCTCAGGG No data
1037477866_1037477873 15 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477873 8:19275489-19275511 GGCTGCACTGGCTCTGGAGCAGG No data
1037477866_1037477867 -7 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477867 8:19275467-19275489 ACCGCAGTGAGTCAACCTGCAGG No data
1037477866_1037477870 3 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477870 8:19275477-19275499 GTCAACCTGCAGGGCTGCACTGG No data
1037477866_1037477872 9 Left 1037477866 8:19275451-19275473 CCTGGGTACACAGTTTACCGCAG No data
Right 1037477872 8:19275483-19275505 CTGCAGGGCTGCACTGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037477866 Original CRISPR CTGCGGTAAACTGTGTACCC AGG (reversed) Intergenic
No off target data available for this crispr